

>tg1661 CTP synthase (pyrG)

>tg1661 CTP synthase (pyrG)

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1566810 - 1569408 (Additional range around tg1661 is :500nt.)

>Thermococcus gammatolerans EJ3 AACAAGTACTTCCTCTTCCAGATCCCGCCACTTGAGAAATCAAACTACGAGATCAGGATTACGGCCGTAGACTTCTACGG AAACAAAGTCACAAAGACCCTCAAGCTGAACTTTGCACCGCAGACGACAACCACCACAACTACAACGACGACAACCACCA CTACGACAACTACTACAACCAGCCCAACCACGACGACAACTTCGGCAACTACCACAACTACTACCTCGAGCATTACCACA ACGACGACAACCACCACGACTACTACCACTACCACTGCCAGCACCAGTGAGTCTACAACAGCCACTACTACCACCACACC CACCACTACCACGACGACTTCCAAGGGTGGTGGCAAGGGCTTCTGTGGCCCAGCTGCCATCGTCGGCCTTGCAATAATAC CCCTCCTTCTCAGAAGAAGGAACTGACCTCCCTTCTCCTTCCCTTAACTTTTTAAACACTCCCGGCTCAATGACCCACAT AACTTCCGGAGGTTTTGCC atgacgaagttcatctttgtcacggggggtgtcgttagcggtctcgggaagggaatcacc agcgcttctctcggcatgctcatgaaggctcgcggttttagaacgacgaacatcaagatcgacccctacctcaactacga cgctgggacaatgaacccctaccagcacggcgaggttttcgttctcgacgacggcggtgaggttgaccttgatttgggca actacgagcgctttctcgacacgagtctgagcttcgaccacaacataaccactggaaaagtgtattccgccgtcatcgag aaggagcggaagggtgaatacctcggcgcgacggttcaggtgattccgcacatcaccaacgagataaaggagcgcatcag gagaatagcaagggactacgacgtcgtcatcgtcgaaatcggcggaaccgttggagacatcgaaggaatgcccttcctag aggcggccagacagatgcaactcgaagaaggcagggagaacgtcgccttcgtccacgtgacctatgtccccaagctcaaa gtggtgggtgagcagaagaccaagccgacccagcacagcgtcaaggagctccgttcccttggaatccagcccgatgcaat agtcgctcgctccgaggagccccttgaggagagtgcgaggaggaagataagcctcttcaccaacgttccagaggaagctg taatcagtgcctacgacgtcgaggacacctacgaagtgcctctaatgctcgagaaggagggactcgcgaggtacctcgtc aggaggctcggccttcccgagagagagcccgaccttgaaaagtggcgcgagatggtggagaagtacaagagccttgataa ggaggtcgagattgcaatagtcgggaagtacgtcaagctggcggactcttacctgagcataaaagaggccttgaagcact cgagcgtggcaaacgatgtcaaggtcaaaatcaggtggatagaggccgaggacgtcgagaggaagggcgttaagctcctc gagggcgttgacggcataatcgtccccgggggctttggagcgcgcggaagcgagggcaagatgatggcgatacgctacgc gagggagaacgatattcctttcctcggaatctgcttcggcttccagctgacggtcgttgagttcgcccgcaacgtcctcg ggctcaagggggcgcactcgacggagatagaccctcagactccttatccggtcgttgacctgatgccggagcagagggat ttggacaggctcggcgggacgatgaggctcggcgcttacccggttcacataaagccgaacaccctcgcgaagaggctcta cggcagggagatagtctacgagaggcacagacaccgctgggaggtcaacccggactacatcgagaagctcgaaagtgccg gccttgtcttcagcgggatagcgggcgatgacgagaggaggatggagatactcgagttgcccgaccacagctacttcata gcgacccagttccacccggagttcaagtcgaggccaatgaacccggcgccggtcttcagggggctcgtcagggcggccag ggaaaggaaatatggggga TGACCCCGTTAGCTTCTGTTCCCTCCTTTATCCCCACGTCACGTTTCTGTTGAAGAGGAA GCGGATGATGAAGGAAACGCCTATGCCGATTAGGTTGGCTATTAGGTAGTGAAGCCCGAGGTAGACAAGGGGTACGTAGA TCGCCCACTGCACGAGGGCACCCATCAGTGCGGCGATGTGGAAACTCAGCAGCCTCCTCCAGAGTGGAGCAGTTCTTAAA TCCCTAAACGTCCAGAGGTCGTTCCACAGGAAGTTGTTCAGTATGGCGAGTTCGGTGGCTGGAACGTTGGCAACGTACTT GCTTAGGCCGAGGTGAACAAAGAGCCAGAGAAAGCCCTCGTTCACAAGGATTCCTGACAAACCAACGATGCTGAACTTCA CGAGCCTGTCCAGTTCCCCCGACCAGCGCATGAGGCGGTAGACGTGCTTGATGTATGAGAGGATAGTTTTCCCACCTAGC TTGCTCTCGCCGGCCTTTCTGAGGCCGAACTTGAAGGGCA