

>tg1662 Metallophosphoesterase

>tg1662 Metallophosphoesterase

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1568485 - 1571686 (Additional range around tg1662 is :500nt.)

>Thermococcus gammatolerans EJ3 CACGAGGGGGACTTCATACCGAAGGAGTACACCTGTGATGGCGACGACACCAACCCGCCGATCTACGTTGGGAAGATCCC TGAGGGCACCAAATCCCTCGTCGTTATAGTCGATGATCCGGACGCACCCGGGGGGACGTTCACCCACTGGATAGCCTGGA ACATTCCGCCGCTCGGGGAGGTTCCCCCGTGGATACCCAAAAAGGGAGAAACCGATGAGCCCATCCACATCGTTCAGGGA AGGAACGACTTTGGACGGATTGGCTACAACGGTCCGTGTCCCCCGCCGGGGAAGGCACACCACTACCACTTCAAGGTTTA TGCCCTGGACAAAGAACTGGGCCTCAAGCCCGGCTCCGGAAGGGATGAGCTTGAGAGGGAGATGAAGGGCCACGTTCTGG CGTGGGGGGAGCTTGTGGGTCTATATCAGCGCGGCTGAGCGCTCGATCGATAGGACAAAGTTTATATCGATTTTTTCGCT CATTTTTCGTGGTGATACC atgagaaaggttgcatttttggttgtgctcctccttgttggagccatctttggaatgagg gggacggggacaacggctgcggcatcgagcgtcagccatacttacagctcagttctcgtggagccttcgccgggagcccc cgccatagcaacgccgggatcggagataaccctaatcccgaaggagggcgtgaacatcaccaaggtcgagattgtctcca tacttcacggaccatacgagcttgaggccttcatgaacggcggcgtcataacggccaggattcccgaagaagtcgtaccc gacgactacttccttatcgtacacacgccctcgggtgaaacggtaattccaaacggcgtctacgtcttcaaggagtatcc cagcgtcctccgcatagcccacctcagcgacacccacataaccagcggttcgaagatcggctacgtatgcggtgacttct tccagcgggacatcttcaagctcgaaaagaactgctccagagttatacccctccacagtgccgtcgcgacagacagcgcc tacacctactggacgatgaaccccggcgcaacgctcatagttaacacgggtgacgacgttgatactgccggtgactacgc cggctatcggataatgctcgatatcctcgagagaacctccgccggcggaaggctcgtcatcaacatcaagggcaaccacg acgatccgccgacggttttcacgaagctcataggtccgaggtacttctacaggataatagggaagttcctcataataggc cttgacagcaggggcgacgaggcccatccagaacttgcccagctcgagtggatggagagcgttctcgaggagcatccgga caagatcccgatagtgctcgtccaccatccgttctggtacagtgcatccctcggcaagaagggcggctacatcaacggaa cggcttttgacaacgagtcttgggcagagatagcgccgcacgtcagctggtactggatcggtgggccggagcacacgagc gaggacatagcaaggcgcttcctccaagacgttgagaagtacaacataacgctcattctgagcggtcacatccaccacga caagacagtcatattcatcgacaaggagggcaggaagcactggttcgccaccctgaccgcaaccggcgctcccgacaagg agaccaacccgccgagcaggcccggaaggagcccgacatggtacggttcgaacctcatcacgatttatgcgaacggcacc gttgagatgaagcccgtcgaggagatgtttggaacggtctttggagacttcgtatcactgccggttccccagaggtttat agtcttcaggcacgagggaagcgatggaactgcgatcaagttcataaacgagtacaggccaattagcggacctctgacgg tcgtggttccggagggagccaaggtagatcccgatgcgaccaacatcacgtacgaggtactcggggagagaacgataggt gacaagcactacatgctcctcaacgtaacgatcccgcttggaacctggcagctcgtagtcgacctcgagaaggacaccaa ggcccccgacctctcgatggcctacaccctcccgagcaagcctgtgccgggcaaggtcataaagctctacgtcagcgcct ccgacaacctcggcatccgcgacctctacgccgagatttacgatgagaatgccggaaagccctttgcctacggaaacacc acacgcttcccggctgaacccgccagtggaaagcccacgaacaagtacttcctcttccagatcccgccacttgagaaatc aaactacgagatcaggattacggccgtagacttctacggaaacaaagtcacaaagaccctcaagctgaactttgcaccgc agacgacaaccaccacaactacaacgacgacaaccaccactacgacaactactacaaccagcccaaccacgacgacaact tcggcaactaccacaactactacctcgagcattaccacaacgacgacaaccaccacgactactaccactaccactgccag caccagtgagtctacaacagccactactaccaccacacccaccactaccacgacgacttccaagggtggtggcaagggct tctgtggcccagctgccatcgtcggccttgcaataatacccctccttctcagaagaaggaac TGACCTCCCTTCTCCTT CCCTTAACTTTTTAAACACTCCCGGCTCAATGACCCACATAACTTCCGGAGGTTTTGCCATGACGAAGTTCATCTTTGTC ACGGGGGGTGTCGTTAGCGGTCTCGGGAAGGGAATCACCAGCGCTTCTCTCGGCATGCTCATGAAGGCTCGCGGTTTTAG AACGACGAACATCAAGATCGACCCCTACCTCAACTACGACGCTGGGACAATGAACCCCTACCAGCACGGCGAGGTTTTCG TTCTCGACGACGGCGGTGAGGTTGACCTTGATTTGGGCAACTACGAGCGCTTTCTCGACACGAGTCTGAGCTTCGACCAC AACATAACCACTGGAAAAGTGTATTCCGCCGTCATCGAGAAGGAGCGGAAGGGTGAATACCTCGGCGCGACGGTTCAGGT GATTCCGCACATCACCAACGAGATAAAGGAGCGCATCAGGAGAATAGCAAGGGACTACGACGTCGTCATCGTCGAAATCG GCG