

>tg1669 Coenzyme A biosynthesis bifunctional protein coaBC (coaBC)

>tg1669 Coenzyme A biosynthesis bifunctional protein coaBC (coaBC)

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1574750 - 1576952 (Additional range around tg1669 is :500nt.)

>Thermococcus gammatolerans EJ3 CTCCGAGCAAGGTCTTTGATGGAACTAGGGTTCTAAAGTCCGGTGCGTACCTTGTTAACGCTTCGATGCCCCTTCAGCGC CTTCTCAGACTCCTGGGGGGCTGGAAGTTGCTGGCCGTTGCAAGGAACGCCGAGAGGTTCAGGGAATCGGACATTCCAAC GCTGTGGATCACGAAGATCAGCGGGGAGAACAGGATCGAGCCTAGTCGGCTTGCGCCCCTTCTGCAGTATATCGTAGACC GGGCGGATGATAACACCGCCGTAATAATTGAGGGGGTTGAGTATCTAATCCTTGAAAACGGTTTTGATGCGGTTTTCAAA TTCCTTACGAGCCTGAAAGACAACATTCTGTCCAGGGGAGCTTTGTTGGTTTTGGTAGTGGATCCCAAAACGCTCGAGGA GAGGGAGCTCAAGTTGCTCGAGCGCGAGTTCTCGTGGCTCAACGTTTCATGAAGAAGTTTTTTTAGCGGGAATGCTCTAA GTCCTTACCGGTGATTTCA atgctccatcacgtcaagcttatctacgcgaccaagagcagaaagctcgtcgggaagaaa atcgttctcgcgattcctggaagcatagccgccgtcgagtgcgtcaagctcgcgagggagctcataaggcacggggcaga ggttcacgcggtgatgagcgagaacgctcagaagataatccacccctacgcgatggagttcgccacaggaaaccctgtcg taacagagataacgggcttcatagagcacgttgaactggctggagagcacgagaacaaggccgacctgattctcgtatgc cctgcgacggcgaacaccataggtaagatagcctgtggcatagatgacacacccgtcacgacggttgtaacgaccgcatt ctcccacactccgattatgatagcccccgcgatgcactcaacgatgtacgaacaccccatagttaaagagaacatcgaga agctcagaaaacttggagtcgagttcatcggcccccgcttcgaggaggggaaagccaaggtcgcttcaatagacgagata gtctaccgcgtcatcagaaagctccaccccaagagcctcgaggggaagcgcgttctggtcacggcaggagcgacgaggga gtacatagacccgattcgctacatcaccaacgcaagcagtggcagaatgggagttgccatagccgaagaggcggacttca ggggggcggaggttacactcatcaggactaaggggagcgtcccgagcttcgtcgagaaccagattgaggtcgagaccgtt gaggagatgctggaggcgatagaaaacgagctgaaggtcaggaaatacgacgtcgtggttttggccgccgccgtaagcga cttccgggtcaaaaaccgggcggatgcaaaaatcaagagcgggaagagtcttatccttgaactcgagccgacgccgaaga taatagaccgcgttaaagaactccagccagacgtattcctcgtgggcttcaaggccgagacgagcgaggataagctcata gaggaagccaggaagcagactgagcgcgcgggaagcgacatggtcgtcgcgaacacgctcaaggcctttggaagcgagga gaacgaagtgttcctcgtcacccgcaatgaagttaagagactgccgaggatgaacaagcgcgagctggcagagaggttat gggatgaaatagaaatgctcatc TGAGCGTCAGATCTCCTTCGGGGGCACGAGGACTCCGAGTTCGGTGATTATTCCCC GGACGTACTTCCAGGGTGTTACATCGAAGAGATAATTCCTCACCCTATGTCCCTGTCTGTGGTAGGGTCGCTCCACTATC TCAACTTCCTCCGCCTCCAGCTCAGGGTGGAACTTGAAACTCTCGGCGGCGACATAGAAGGGGACTCCAGCGTCATGGCA AGCAAGTGCAAGGAGGTATGTTCCGGCTTTGTTGAGGACGGCTCCGTCTCTCGTCACGTTGTCGGCTCCCACGAGTGCAA GAGTTGCCCTTCTTGCGAAGAGACCGAGCTGGGCGTCTGTTATGACCTCGTGAGGGATGCCTAGAAAGTCAAGCTCGTTC GCGAGGGCTATCCCCTCGTAGTCCGGTGAGCTCTCGGTAAGAATGACTCTGAACCTCTTCCCCTTTCTCCACGCGGAGCT GAGCACCTCCAGAACGGCCGATGAGAACGAATGGGTTATCACGA