tg1691

Coordinates:1595386-1595532

>tg1691 hypothetical protein TGAM_1691
MLARILYYREKEMPWEIVIPANDIKKAERIAREKMSEFNAIAYEVELIA

>tg1691 hypothetical protein TGAM_1691
atgcttgcgagaatactctactatcgggagaaagagatgccttgggagatcgttatccccgcgaacgatatcaaaaaggc
cgagaggatagcgagggagaagatgagtgagttcaacgctatagcatacgaggtcgagctcatagca


Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1594886 - 1596032 (Additional range around tg1691 is :500nt.)

>Thermococcus gammatolerans EJ3 GGGGCCTCTTCGAGGTGGTTATAACCAACGACGTGGAGAGAATGCTCTCCTATCTCTCTCGGCTCGGCCTTCGATGATTT CGTTTTTTGACGAAATGTCTAAAATCTGGTGCGTTAAACTTATAAAGTTTGAACAATTGACAAACAGCTCGGTGGGAGAA TGAAGTGGGCCGTGACTCTCTACGGGGGAAGATCCCACAGAGAAAGGATAACATTTGAGGCTGAAAACGCCGATCTCGCC CGCAGGATCGCGGTAAAGGAGCTTAAAGCTAAAAACGCCAGGGTTTTTGAACTAGAAAGGCTCGATTGAATTAGTTCTGC GTCCCTTTCTTATTCCTTCTCCTTTCCCCTCTCGTTCGCTGAACATCCTCGGCTATGGGGTCTTTTCAGTTCATTAATGT TCTCCGAATTCTGTTCGTTGGTGTTCAATGATGTTCAGCAAAGCTTTTAAATTGAACTCCAGTGCTTTTCACGCCGAGTG ATACAGAGGGGGTGATGGC atgcttgcgagaatactctactatcgggagaaagagatgccttgggagatcgttatcccc gcgaacgatatcaaaaaggccgagaggatagcgagggagaagatgagtgagttcaacgctatagcatacgaggtcgagct catagca TGACGCTCCTCCCCTCCTCCCCTTTGCCATTTCTCACCGGGCAAAAAGTTAAAGAATCAGCTCTCGCCCTCG ATCTCTATGACCTTGACGTAGATCGGGAGCTCCGAGAGTTCTGAAAACGTTCTCTCAGCGGCCCTTCTTGAGCGGGCGAG CATTACAAAGGCTATATCTCCTTTGTAGCGGGCTTCAGTGAAGCTTATTATATCACCCCTCGCTATTCCGTAACCGATTG TCCTCCTGACCTGATCCTCATATTTTCCCACCAGCTTTTCGGGTATGCTGAGCAGGACTCCGTAGATCATCCCATCACCT CCAAACCGATAGCCTACCGATAGCCTTAGGAAAATTTAAAAATGTGAAGGTGTCACGCGGTCAGCCGCCCGCCCCGCGCG AACGTTCGTTCGCTGGGTCTCGTGGTCATCCACGAGACTGCGTGAGCTTACGCTCACTGGTCGCGCGTTTACCCGCGCGA CTGCTTGAACTGCTCCTGTATCTTCCTG