

>tg1695 Permease, major facilitator superfamily

>tg1695 Permease, major facilitator superfamily

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1597029 - 1599387 (Additional range around tg1695 is :500nt.)

>Thermococcus gammatolerans EJ3 TCCAATCGGGGACGTCAGTTGAGATGACGGTTCTACCGAGAATCTTCCGCCGTTCCAGGGAACTGAGAAGGGGCTCAAGC GCATTTATGTCCTTCAGGTCGGCGTTAACGACGCCCGGGCGGAGTTTCAAGACCCGGTCCAGAGTTGGGATCAGCTTTCC AAGGGGATGAAGCTTCACGAGCTCCCCGTAGGTCAGAAGCTCCACACGATACTGCCGACCGTCAACCGTGAAAACTCCCT CGTGAAGGGGAACGAGTTTGCCATCCATCGTTATCCTCACGTCGAACTCTATACCATGACAGTGGTTAAGGGCCCTTCGA AATGCTGGAATAGTGTTTTCCAACGGCCCTTTTGTTCCCCTGTGACCCAATATGAAAATATCTCCAATGTCCCCTTGTGT CATACGTCCAACCGTTCAAACATGCGCTCACAATTCTTAAAAGTTCTTCCAGACAATTTTTCCCGTTATTGCTCTCTAAA ATCTTCGGGGGGATGGAACT gtggagttcaaatattcccgcatattcctgctcggcttcggtttctttggtataagcat aatatgggcgctttacaacgcgtacataccgatattcctccaggacacgttcagaatgaacagaacggtgacgggcttca taatgacgatagacaacctcttcgccgtcctgttgctcccgtttttgggcgcgctcagtgacatgacgcgaacaaagctc gggaggagaaagccctacatactcctcggtgccccctctgcggctctcatgttcgctctcatccccatagccagggagca cggcaatttagccctcttcatgggcacaataatcctcatgaacttcttcatggccctcttccgctccccggtcatagcct tcatgccggatataacaccaagcgaaaagaggagccaggccaacgggataatcaacttcatgggcggtcttggagccctg ctcgcgtacttcggcgggaaggtcctctacgagatgaactacgcctaccccttctacttcggagcggcgataatgcttct ggcgaaccttttggttgtcctcttcgtgcccgagccagaggagtacagggttccgggggagggcataagcctgaggaagc tcctttccgagacttcccacaagagcttcggtgagctcaaggagaacctcaaggacgtttttgcaagccacgaaaagagc ctgctcgcgatcctgctcgcgatattcttctggttcgttgccttcaactccctcgagacgttcttcacgagctacgtcaa gtaccacctctacgggatcccagttggcgcgccggaaaccgagctcacgaggaagatcgagagcacaggggcctttatgc tcggtgtcttcagcctgagcttcatgctcttcgcaatccctgccggcttcattggtgcaaggctaggcaggaagaagacg ataacactgggccttctcctggtcatagtgataatgctcggggcattcttcatcggggaaacctcaaaaccatcaagccc aagcctctcggattcagtaataatgaccttcatggggctgttcttcctgggtggaatcgggtgggcgatgatcaacgtga actccctgccaatggtcgtggacatgacgacggaggaaaagcttggtggctacaccggcctctactacttcttcagccag gcggcaaacctcctcgcaccacccctcgcgggagcgttccttgacgtcataggctacaaaacactacttcccttcgcaat ggtgttctttgtcttagccctgataacggtgcagttcgttaggaggggagatgttgttaaaagcaccggggacacgtatg attacatacccgatatggat TGAGAGGTGAGGGAGATGGAAAGGCGTTTCAACTGGGGTATTGTGCTCGGTCTCGCGCT GCTTGGGTTCAGCAGGAGCGTTGGATGGGCCATGAACAAGGGGCTGTCATTCCCTCTTCTTTCAAGCTACACCCAATCGG CCCTAGTTAAGGGTACAATCCTGGCCCTTGAGGGCCTGATAGGACTCTTTGTCCCTGTGGTTTTGGGGTATTACAGCGAT ACCCTCCGCTCCAAGTACGGCAGGAGAAGACCCTTCATAATGATCGGGGGTATCCTCGCGGGCGTGGCGGCACTGATGAT ATACACCTCGTACGCCCTCGGTGTTCCCCTGGCGGGCTTTGCTCTCTCGCTGGCGTTCTTCTACCTCTCAATGCACCTCT ACACGGCACAGTACAGGGCACTAATGCCCGACACAGTGGAGAGCGGTCAGAGGGGGAAAGCAAGTGGTGTCATCACCTTC TTCGAGTGGGCGGGCAACCTCTTCTTCTTCGGTCTGGCAG