

>tg1720 RNA-metabolising metallo-beta-lactamase, beta-CASP family protein

>tg1720 RNA-metabolising metallo-beta-lactamase, beta-CASP family protein

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1625225 - 1628177 (Additional range around tg1720 is :500nt.)

>Thermococcus gammatolerans EJ3 ACGTCAAAGGAGGTAACAAAGGTTTTCCAGATAGACGATCATCTCGCCATAGCCGGTGCCGGTCTCGTTGGCGACATACT CAGTCTCGTCAGACTTCTCAGGGCGGAGGCCAAGCTCTACAGGGCAAAGGTCGGCAGGGAGATGTCAGTTAAAGCTCTGG CAACACTTGTTTCGAACGTTCTGCACGGGAGCAGACACCTCCCCTACTTCGCCTGGTTCTTGATCGGGGGGTACGATGTG AAGCCAAGGCTTTACTCGATAGACGCCGCGGGAGGCGTTACCGAGGAGCGCTTCATCGCGGCCGGTTCTGGTATGGAGTT CGCCCTCGCCCTTCTTGAGGAAAACTTCTCCGATGGGATGGGCCTTGATGAGGGCATTGATCTGGCCGTTAGAGCCGTTA AGGCCGCCATAAGAAGGGATGTTTACACCGGCGAGGGAGTTACGGTCGTCGCGATCACAAAGGAGGGCTACCGTGAGCTT GAACCGGTTCTGAAGTGAG gtgatgggcttgatcaggagagaaactttcgtcgaggacatactcaaggacataagggct gtcatcaaccagatggttccaaaagaggcgaaggtgaccgaggttgagttcgaggggcctgagctggtcatctacgtcaa gaaccccgaggcaataatgcgcgacggcgacctgataaggaaccttgccaaagtgctcaagaagaggataagcgtccgcc cggatccggacatcctgatacctcccgagaaggctgaggagatgataaagcagatcgtcccgccagaggcggagataacc aacataagcttcgacccctccgttggtgaggtcattatagaggccagaaaacccggcctcgtgataggtaagaacggcga aacgctccgcctcatcacccagaaggttcactgggcaccgaaggcgataagaacccctccgatacagagtcagacgatct actcgatcagacagatcctccagacggagagcaaggacaggaggaagttcctgaggcaggtcggcaggaacatctaccgc aaacccgagtacaagagtaggtggataaggattaccggccttgggggcttccgcgaggtcggcaggagcgcgctccttgt ccagacggatgagagctacgttctggtggactttggtgtgaacatagccgcgatgagggatcctctcaaagcgtttccgc acttcgacgcccctgagttccgttacgttctcgatgagggccttctggacgcgataatcataacccacgcccacctcgac cacagcggaatgcttccctacctcttccgctacaagctctttgacgggccgatttacaccacccccccgacgagggatct gatgaccctcctccagcaggacttcatcgagatccagcacatgaacggaatggagcccctctaccggccgagggacataa aggaggtcataaagcacaccataaccctcgactacggcgaggtcagggacatagcccccgacataaggctcacccttcac aacgccggtcatatcctcggctcggccatagtccacctccacatcggcaacggactgcacaacatagccataaccggtga cttcaagttcatcccaacgaggctccttgagcccgccgtcagcaggttcccgcgagttgagaccctcgttatggagtcca cctacggtggaagcaacgactaccagatgccccgcgatgaggccgagaagaggctcatagaggtcatccaccacacgata aagcgcggaggaaaggttctaatccccgcgatggccgtcggcagggcccaggagataatgatggtcctcgaggagtacgc gcgcgtcggcggcatagacgttccgatttacctcgacggaatgatctgggaggcaacggcgattcacacggcttatccag agtacctcagcagaaggctgagggagcagatcttccacgagggctacaacccgttcctcaacccaatattcaagagcgtc gccaactcgcgcgagaggcaggacattatagactctggagagccggcgataatcatagccacatcgggcatgctcgtcgg cggtccgagcgtggagtacttcaagcagctcgcccccgatccgaagaacagcataatcttcgtcagctaccaggccgagg ggacgctcggaaggcaggtgcagaggggcctacgcgagataccgctcgtcggggaggatggcaggacggaagtggttcag gtcaacatggaggtgcacacgatagacggcttctcaggccacgcagacagaagggaactcataagctacgtcgcccggtt aaggccgaggccggaacgcgtcataacagttcacggcgagccccacaagtgcctcgacctcgcatccagtctgcacaaga agttcaacctctcgacaagggcccccaacaacctcgacgccataaggttgaag TGAGGTGGAAACCATGCTCTCACTCC TTCTCCTTTTGGGTTACGTGCTTCTAGTTGTGGTTCTCGGCTCGATAATGCTAATCAGGGGCTTATCCTGGTTTGAAAGG CTCGACCGCGTCCTGCCGATGGTCAGCGAAAGGCGCTGCTTTGCCTACGGCTTTGTCGCCGTTGTGGTTGCTGTGATTGT TGAACTAAGTGGCTTTTTCCTGCTCAAGGAGGCCATCGCCAGCGGTACGATGCATTCCTCCTTACTCCTCGCCTCCATTG TCGTGCTCCTAATAGGGTTTGCTGAGGAAGGGGCCAAGCTCATCCCCTTCGTCGTTGAAAAAGGGGATACACTCACCAGA TGGCGCTTCGCAGTTAGAGGGGCCTTCTACTTCGGCATCATCGAGGCGGTGCTCTATGCCTTTAACCTCCTGATGATGGG CAACCTGATTGCGGCCCTGTTGAGGTTCCTGGTGATCATGGTCCACGTTGTGCTCACGGCCATTGCCCTGGAAT