

>tg1734 Na+/H+ antiporter, napA type (napA)

>tg1734 Na+/H+ antiporter, napA type (napA)

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1640748 - 1643079 (Additional range around tg1734 is :500nt.)

>Thermococcus gammatolerans EJ3 AACCGGTGGTGACTGTGTATGACATTGAAAGGGCCCTTCAGAGTTTCCATTCCATGAAGCTGGACGACATTATGCCCCCG ATAGCCTCGATGCCAGTCGTCACGGTCGATACTTCCGTTCTCACTGTACTAAAAATCCTAAGGACAAGGCACCACGTGTG GGTCGTTGAGGACAGGGAGAGCATGAGGCTCAAGGGCGTCATCAGGTACCTGGACGTCATAGACATACTCCTTCCCCCCG AGGCCTACAAGTTCAAGCTCGGGATGACCAGCAGGAGTCTGAGGTCAATACTGGGAGGGGCTGAGAAAGCCATCGACGTT GCCGAGAGGGACGTTCTCACGATCGAGAGGGACTCGACGGTTCTCGACGCCCTTCTCAAGATGAGGCGGTACAGGGCTCA GGTGCTCGCGGTCGTTGATGGCGATCGCCTGGTCGGAGAGGTCAGCCTTCGCCTCCTTATCAACGAGTTCCTTAGACTGC TGAGGGTGGGGGATGTGAA atggacgcgacatggctcctcttcacaatcggaatctccctgatcctggcaaaaataggc gacagcataatcgagaggtttgaactgcccggtgtcctcggggagctcctcatgggaatgctcctcgggaacctcgttta ctttggaatcgtggcgccgcaataccttcccatcgtctccgaccaaggctttgaaacaaccgccgcggagatctcggatt ttctggcgaagctcggtataatattcctcctctttctgggcgccctcgatactgacgttgagcagctgaaaaaaaccggc ctgacggctaccgtttcaactgtgttgggcgttttcgtcccactggtaataggctggtacgccctcatggccatgggcta cccgagcagggaggccttcgccggcggtgtcctgctgacggctacaagcatagggctgacggtaagggtcatgatggatc tcggcgttctgaggagtgaggttggtgcggcatcgctgagcgcgagcgtcatggacgacttcctcggcatagcgctggtc atcttcgcggttggaagcggcagtttgctcgacctgagcgtcaagatagtggcgttcttcataataaccggcgtccttgg ctggtacgtcattgaccactacgtccgcttcgccgagcggctccacgtggagaagggcatcctcgggatggcggttggca tgatgttcctcttcgcggcactggctgaaggctggtttgcggcggccatcgagggtgccttcatgatgggcctgatcctg tccaagcttccagagggcaaaaggataatggaggacgtcagggccataggatacggcctcctcgtgcctttcttcttcgt gcataccggggcgatgctcgacctcagggtcttcgagaactggaacgcgattacgctcgcagcggtgctctcaacggtgg cgataatcggaaaagttgtgggcaggggctttggagcgtggataaccgcgtggggacgcggcagggacttcctgtttacg agggataacttctggatgtccctccagatgggaataggctcgatacctaggacggaggttgccctcgtcgatctgatggt tgcgatacagggtggggctatccctcagaaggacgcgccggagttcatagcagcaacgctgatattcataacggtctcgg tgctgataacgccgccactcctcaagtgggccttcaggagggacatcgagagcgcaatcatccagaaggtcgaggagagg aagagcaggatctcggaaaggaagagaaaggtcgctcagaagaagcaggagtcagaaccgaagagtggggcg TGATTTT ATTCCTTTTTCTGCTTTTCCGCACCCCACAGGGGCTCCCAGTCGTCGCAGACGAAGTTCATGTGGACGGTCTTCATGTGC TTCCTGCACATCCCGTAGGTCAGGAAGTAGGAGTCAATCGGCCCGAACCAGCGACAGTTCTTGCAGGCTTTTAGGTTCTC GTCCATTTTGCTCACCAGGGAGAATAAGAAGGGAGGGATAAAAAACCTTCAGATTCCAGCTCCAATGTCGTCCGCGATGT CCGGCAGGTCGAGGGCCATGAGCTTGGCCTTGGTCGGGATTCCGTCCCTGCTCCATCCGCGAGCCTGATAGTACTCGTCG AGCATCCTGTCGAGCTCCCACGGCGGGACGTGGAGGCCCTTGCTCGGCCCCTCGGGAATCGGCTCCCACATAATCCTGTA AGGTAGGGTGTCATCCTTCCTGCTGAAGCCCTCGCGGACGTTGAATGCCCTTGCGATGTTCATTATCCTCTCGCCGATGA CCATCAGCTCGGC