

>tg1743 DNA double-strand break repair protein mre11 (mre11)

>tg1743 DNA double-strand break repair protein mre11 (mre11)

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1650444 - 1652829 (Additional range around tg1743 is :500nt.)

>Thermococcus gammatolerans EJ3 ACTCGAAGCCTACCCCGCAATAAGGAAGCCAATCCTCGTCATAGTTGAAGAAGCCCACATATTCGCGCCGAGGGGCGAGA AGAACCCCGCAACCCTGTGGCTCGGCAAGATAGCCCGAGAGGGGAGAAAGTTCGGCGTGGGCCTTGGAATAGTGTCCCAG AGGCCGAAGAAGCTCGACGACGACATACTCAGCCAGACCAACACAAAGATAATCCTCAAGCTGGTTGAGCCCAACGACCA GCGCTACGTCCAGCAGGCGAGCGAGCAGATAAGCGAGGACCTGCTGAGCGATATAGCCTCGCTGGGCGTCGGCGAGGCGG TGATAGTGGGCTACGCAATCACGATTCCGGCGATGGTGAAGGTTTATAACTTCGAGAAGGACTTCAACGGCCACTATGGA GGAAGGGACATAGACATCGTCGAGGAGTGGCTCGAGGGGAAGGAGGAAGAGGTGAGCGAGGAGGAGGCGATAGCTTCCCT CCCCCTGTGAGGTGTTAAG atgaggttcgcgcacatagccgatgcccatctcggccgggagcagttcaaccagcccttc cgctacgaggactacgttaaagcgtttcgtgaggccgtcgagaaggccgttaaggccagggtggacttcatactcatcgc cggagacctcttccacgtgagcaggccgtcgcctaaggccctgcgcgatgcggtcgagatactcgaaatcccgaggagaa aggaaatccctgtcttcgccatcgagggcaaccacgacaagacgattagagaggcttccgtcttcgacctgctcgaacac ctcggcctaatcaggaccctcggcctcagaagagaggaaaagcgggacgagttcctgcggagcaaaaagattgccgaccg ctacctcgtctgggcagaggtcggagacctcaaaatctacggcttaagacatcacacgcgctggcagctcataaggggta acaccaacgtcctgaaggccctcttcaagaggggagacatcctgatgctccaccaggcggttgactacctcgctaaggac acaccgtatcaggacgccttcgacctcaagctcagcgaactccctgataacttctcctactacgccctcggacacataca cgtgagaaagctggccgagcccgagcagacgggtctaaagggcccgatagcatatcctggctccaccgagagaaccgacg tgagggaggcgagccacgtagtagtttacggcgagagggacagaaagccgaagctccgcgagaacccccagcctaagggc ttctacatcgttgaggacttccggccggagttcgtcgaggtcgagacgaggcccttctaccgcgttacggtttcgggaaa ctccaaggccgagctcaggaggaaggtggaggaggtagcgggtctgattccaaaagatgcggtggcaatcatctaccttg agggaacggtgaaaggtggcgttagtttagctgagttcaacgacctgctgaagggctctggcatagcctactacgccttc aggagcagggtcacgggcgaggcgataatctctaaggagcgcgtgggcgaggagatactgaccgagtgggagagggagct cttcctccacctgcggagtgaaccaaaggagttcccgctcgacgagttcatggactggctccttgagaagtaccgcctcg gcgttccggaagggatgagtgcaagggcccgcaaaccagtggaagagccgaagaaaccagaaaatgccgaagagaaacgg ccgaaaggggaaaagcgcgtgaaagcaactccaaagaaggagaaaatagagaagcccaaaaccgagaagaaaacgagacc ggcaaagccgtcgagcctcgatgcgtggctcaggggtggcaggcaa TGAGGGTCAGGAAAATCGAGATTCGGAACTTCA GGGCCCACAGGAAAAGCATTGTTGAGTTCAGCGACGGCATAAACCTGATAATCGGCCAGAATGGAGCCGGGAAGAGCTCA ATCCTTGAGGCCATCTTTGCCTCGCTTTACCTCGGACACCCGAGCTTCCCGAAGGGCTATCTGAAGGCCAACGCCCGCGT CGGAACCGGGGAGCTTTCCCTGGGCCTGGAGTTCGAGCACAACGGCAAAACCTACCGCATAACCCGGACGACGAAGAAGA GCGAGCTCCTCGAGAACGGAAAACTTATTGCGGAGAAGAGCTCCGAGGTAGCGCGCTGGGTCGAGAGGAACGTTTACCCC CTGCAGGTCTATACGAACGCCCTCTACATCCGACAGGGCGAGATTGAGGGCATAATCACCAACCGCGAGGTCATGGAAAA GGTTCTGCGCAAGGTTCTCGGCATAGAGGACTACGAGAACGCCGAGAGGAACTCGGCAGAGGTAATC