

>tg1748 Regulatory protein HTH/ArsR family, disease resistance-related, containing ATPase domain

>tg1748 Regulatory protein HTH/ArsR family, disease resistance-related, containing ATPase domain

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1670128 - 1673458 (Additional range around tg1748 is :500nt.)

>Thermococcus gammatolerans EJ3 GACCATACGGGCTGAAGTAACCGGTGAAGGGTACGCCGTGCTCTTGATGCCCTTGGAGGGGATGAGAGTAGTGAGTGTTA CCCTTGAAAAGGATGGGATAACCTACAAGCTAAGTGAAGGCATGGGCAGTGTAGGATACTACGGAGCGCTTGGAGAGTAC GTTTACGTCCTCATTCACGGTGCTTCCACAGTCCATATACAGCTTGAAAGCCCGGCGCGGAGATTTGATCCTTACTGGGC GTGGTTCCTACTCGGCATGAAGTGGGAGAAGAGATACCTGGAGCTCAAAGACACTTTCGAGGCAATTGAACCCAGAGCGG AAGAGGAGAAGATCTTGGAGAAGGCTTTGGCTCTCCACAGAAAAGCAGAAGAGTACTACCTCTTCGGGAAGATGTACTGC CTGCACGACCCAATGAGGTATGCAATCTACATGAGAAGGGCTTACTTCCTGGAAAAGAGGGCCTTGAAGCTGCTGATGAG AGCTCTATAAGTCTCGGAA gtgatttatacccccttctcctattttgtttgggggatcgtggtggagccaatctccctg cttaaagttctctccagcgagacaaacctccagatactgtccctgctcaggtcgggctcttttcacccgagggagctcgc aagactccttcataggagcgagagcgacgtttctaggaggcttaagaagctcgaaaagctcggcctcgttgaagggagat gggttcggctgggcgatagaaacgtgagggtgtactccctcaaagtggatgaagtgaagatagacttcctccccgaaaag gtgcaggttgatatcggggagaaggaggactatacagtccccataaccgcgggagaggttccagaagttaagttcttcgt tggaaggggtgaggagatagagatcctcaggagctcgaagggaaagctggttgttgtgtatgggatagcaggaataggaa agaccagcctgctggcgaaggcctttcctgaggcgttctggtacaccttagacgggtcggagagcatggaatacctcgcg tggcagctggggctttacctcaactccctcgggtacacggcacttctcgaatacctccgaagtggcggaaagggagagag ggaaatcttcgagcttatcttggacgggttggaggaaacagaaagcgtcgtcataatagacgacctccacaagtgccaag acgatgccgtgaagaggcttctgacgtaccttgcagggaagcttaggaacggcaccgtggccgttgcatcgaggatcaaa ccgatgctgggcatagaaggtgtggtctacataaacctcggcggtctgaagcccagggaagcgtacgaactagccaagaa cgtccggggcgaggtctcggtcgaggagttcgcgaggatatacaggataacccggggccacccactggccatcatactcc tccttgagagccccgaactgagcgaggaggtagttagggagaacttcttcgagttcctgttcatggagatataccagtcc ctcagcgcggacgaaaggcgaatgctgtcgattctcagcctgtttgaggggccgcttgaatacgatgccataaagaccct ttacggcaaaaagaacgctttccccgttctccattccctcctcaggaagggtctggtggagaggaggggaagaaactact tcgtccacgatatgctgaggggctttttaaaggaggccgaatcggtgaactccaaggaatattacctgacctatgcagac tacctcctcgaaaaaaataacccgcacgacttccttaaggccttcgagtacacactcaaagccggtgcctattacaaaat caaagacctagtgctgttgaggctgaagaagttcaagcacgtggtaggggacttcccaaaaacgtaccggaggatactca ttcaagtaagcgacaacccctatgccaaggccgagctgggaataatatacttcaccacaggctttttccagaaggctcgg gatattttaatggaggtcgagtacgaggtcgagggtatatttagggcggaggtcgtgggcatcctcgccgacgtactgat ctcgatggaggaatttgaaaaagccgaagagtatcttgaaaagctgcagaggctcgcggaagaactggacgatccggacg tttggctgtggtactacatggagaaaacaaagtacgagtactaccaggaacggcccgaaaaggccctggagagcgcgttt aaggagcttgagatctcacggaggcaagccaatctgcctgagaatgaggcgctcgtgcttctccacataggtgatatata cctcgaaatggagatgcccgaaaaagctgtgaggtactacaaggaaagtctcgaggtatcaagggtctatgggatgctct ccctcgaacacctagcctatatggagttatcaaagtgccactatatactcgggaactatgagaaggccatttcctacggc actagggcagtagagtacttcacgaggatcagaaactacagaaggactgtggataccctagcctaccgttgcgtctcgtg gatagctctggacgatgctgaaagagcagaaaaagacgcgagggaaatgataaagatagctcacggtacaggatatcctc tagggtgggctggctacatcttcctcggcacgtctaaaatactcaggggccaagatggcagcgaatacctcaagaaaggt agagaacaccttaaagaatacccctggctctacgatgctgttatggaggaacttggaaaggtcttcgacacgtcgctcct cgaagaaaccactacagcaccgcaagccaat TAAATCTCTCAACAACTTAGCTAGGCGGTCTAAAAGCCGCCGATTTTC AATGAAACATAATCGGGACCAAAAATACACGTTATTGCCCAATTTTGGGGAAGAAACGCCTATTGTAGCTTTTCCAACAT TTCGGTATTGAACCAAAAAATTATTATACCTTGAAGGACTAACCTTGAACACGAACGTAAGGGGAGCCCGGACTGTGGGC TCTAATAACGTGCGGTTCTAATAACCCTCCCGTGTCTGTGCAGCCCGGCTCTTCTTGCGTTGGAGGTGATCCACGTGAAA GTGAAAAAGAGCGCGCTCTTTTTGTTCTACCTCTTAATCAGCTCCTACCTAAACGTGGGTTTCGTTGGATTCCTCCATCC CGTTCAGGCTCAAAGTCCCGTTTTCCAGGACGACTTCAACGACAACAGCCTTGACACCAGCAAATGGACAGAGGACGTCG TGGGGAGCGGGAACAGCTACACGGAGGCAAATGGTGAAGCGCAGTTTATCAC