

>tg1753 Pyruvate carboxylase subunit B (pycB)

>tg1753 Pyruvate carboxylase subunit B (pycB)

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1691187 - 1693971 (Additional range around tg1753 is :500nt.)

>Thermococcus gammatolerans EJ3 ACGACCTCGGCTTCCCGGTTGTGCAGTTCGCCTATCCGCGCGGACCGTACATAAACGAGAAGTACGGCAAGAAAGAGGAC TACCGCGTCGTCATGTACGGGGCGAGAGCTGCGGCAGAGAGTGGCGCGGACATGATAAAGACCTACTGGACTGGCTCAAG GGAGACCTTCGCAAAGGTCGTTGAGGCTGCTGCAGGAGTTCCCGTCCTACTGAGTGGTGGAGCGAAGACCGAGAATCCAG TTGACTTCCTGAAGGTTGTGTGGGAAGTCATAGAGGCCGGCGGCTCTGGAGCGGTCGTCGGGAGGAACATCTTCCAGCGT GAGAACCCGGAGCCCTTCATAAAGGCCCTTCTTCGCGTTGTCCACAGGAACGAGGACCCGGAGGAGGCAGCTAAGGCAGA GGGCCTGCTCTGATTTCGACAGCTGTCTAACTCCTTTTCTTTTGCCGTCGTAAGGCTTTTAAAGGCTCCGCTTCTGTGGG CATTAAAAGGGTGAAGAAA atggcaaaggttgacataattgacacaacctttagggacgctcaccagtcactcatagca accagactaacgactgatgacatgctaaagatagcggaaacgatggacagaatcggcttctactcgatggaggtctgggg aggggcgaccttcgacgtctgcatacgctaccttaaggaagacccctgggagaggcttcgcctcctcagggagcacataa ggaagacgaagctccagatgttgctgaggggccagaacgtggtcggctataagcactatcccgacgatgttgtagagaag ttcgtcgagctggcccacaagaacggaatagacatattcaggattttcgacgccctcaacgacgtccgcaacatggaggt cgcgataaggaaggccaaggaagtcggagctgaagtacagggggcgatagcatacacaaccggcaaagtcttcacgctgg agtactacatgaagaaggtcgaggagctcctaaagcttgacgtcgacgtcataacgattaaggacatggccggcctgctt accccctggaagatctacgagctggtcagcgagataaaggaaacctacggcatccccgttaacgtccacacccactcgac gaccggaatggcggtggccgtctatctgaagggtgttgaggcgggtgccgattacatagacactgcgataagcccgctcg ccttcggaacggcccagcctggaatccagacgatatggcacgcccttcccgaagcggtcgggagccacctcgacagggag ctgatccacagggtctcccgctacctgaagaaactgctcgaggagaagtactggggactgctccacaaggaaacgctcat tgtgaacccctacgtcctcaagtaccaggttcccggcgggatgttctctaacctcatcgcccagctcaaggagatgaacg ccctcgacagactcgatgaggtcctcgaggagattccccgcgttagagaagacctcggctggcccccgctcgtgacgccg acgagccagatagttggaactcaggcggttctcaacgttctcttcgggcggtacaagcagataacgcaacaggttaaaga ctacatcaggggcctctacggaaggcctccagcggagataaaccccgagctcaaaaggctcgtcctcggcgacgaggagc cgataaaggagaggccggggagcctgctcaagccccagcttgaggagtgcaggagaaagctcgaggagctcggctacctc cacaaggaggaggacgttctaacctactgcctcttcccggaggttgccctcgagttcttcagggcgagggctgaggggag ggtgaaggtcgagcttccaaagacggcatcaaaggtcaaggtttacgtcaacggcgtcgagttcgaggtcggaattgagg gtgttgatttgagcgctctcaagtacctgtcgagggtccagggaattacccccgctcagactggttcccctgagcctgtg caggtttcggctcctgctccagctcctgtgtcagttcctgctcctgcctctactccagctcctgcgagtgcttcgcccaa caccgttaccgccccaatgccgggtaagattcttagagtcctcgtgaaggaggggcaggaggttaaggctggtcagggtt tgcttgtgcttgaggctatgaagatggagaacgaaattcccgctccgaaagacggtgttgtgaagaaaatctacgtgaag gaaggcgacgccgtaaacaccggcgacccactgatcgagctcggg TGAGCAAAACTCTAATATACCCTTTCCTTTATTC ACTCTTGGTGATACATGTGGGTAAGAATGTTGTCCTCGCACTCATCTTTCTCCTGATAGGGGGAGTTTTCGCGGCTGGAT GCCTCGGCGGCGGTTCAAATGGGGCTTCAACGACGTCCGGCTTTTCCCAAACTACATCGAGTACAACGACCACAGTGTCC TCCTGCTCTACCTCAACGACTTATTCCACAACCACTTCCACGATATCCACGACGACTCAAACGAGCCAAACAACCACCTC ACCTACAGCAACCCCTTCACCGGGGCCCGGCTACAAGGTGATTTACCTTACGACGTCCTCCGGTTCCTGTCCGTCCGGAA AGATTCCGGTGGAGTTTGTTTACAACCCCGGAAACAAGACCGTGAAGCGCGTAAGCCTCAGGGGAACGTTCAACGACTGG AGCCAGTGGCTTATGCACAAAAAGCCCGATGGAAGATGGGTTCTCAGGATATGCCTCGCCCCCGGA