

>tg1775 Glutamyl-tRNA synthetase (gltX)

>tg1775 Glutamyl-tRNA synthetase (gltX)

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1714239 - 1716951 (Additional range around tg1775 is :500nt.)

>Thermococcus gammatolerans EJ3 AGGGCAAGAACTTCTACGAGATTCTCAAAGAAAAAGAAAGAACTGCGCCCTCCAAGGAGGTCAAGCCCGCTCCAAAGCAC GAGCCAAAGCCCCAGCCCGTGGAGCAGAAGCCGAGGGAAGAGAAAATAATCCGGCCCATCCAGCAGGCAAAGAGCCCGGA GATAGAAAAGTTCGAGAAGTTCATAGAGCGCGTTAAGAAGGAGCAGACGGCCATACTCCTTGACGAGAACATGAACGTCA TCGCCGAGATTCCTGTTAGGGATCTGCTCACGACGATCTCTACCAGGGATAACATTTACGCCATAGTCTTCAACGGGATA ATCACTCAGAGGCTCATAGACATAGTCAGCGAGAACAACGTCCGCTACCTCGTCGGGGCGAGGAAGGCCAACGTCGTCAG AAGGCCGGTGAACCTCAAGATACTGACCTTTGCCGAGTGATCCTTTCCTTAACTTTAACCTTTATAACCTCCCCGCCTCT TCTTTTTCCGGTGATGTGA atggtagagcggctgatctggaagtacgcgctcatcaacgcctacacccacaagggtaag gcaaacccaaaggcggtcataggtaaggttctcggcgagaacccggagctgaggccgagggcaaaggagataatcccgct cgtgaacgagatagttgagaaggtaaacgccctctcccttgaggagcaggaggcgaagctgagggagatttaccccgaat tctttgaggagaagaaggccaagaaggaagagaagaagggccttcccccgcttcccagggcggagaagggaaaggtcgtc acccgctttgcccctaaccccgacggtgccttccaccttggaaacgcgagggccgctattctgagccacgagtacgcgag gatgtacgacggcaagttcatactccgctttgacgacaccgaccccaaggtaaaacggccggagccgattttctacgagt ggattaaggaggaccttgagtggctcggcttcaagattgacgagatacacatagcgagcgacaggcttgagatatactac gactacgctgaaaagttgataaagatgggcaaggcctacgtctgtacctgcccgcctgagaagttccgcgagttaaggga caagggaatagcctgcccgcacagggacgagccggttgaggttcagctcgaacgctggaggaagatgctgaacggagagt acaaggagggtgaagctgtcgtcagaataaagaccgacctaaaacaccccaatcccgctgtcagggactggcccgctctg agaatcatagacaaccccaaccacccgaggactggcaacaagtaccgcgtctggcccctctacaacttcgcatctgccat agacgaccacgagctcggcgtcactcacatcttccgcggacaggagcacgccgagaacgagacgaggcagaggtacgttt atgagtatctcggctgggagtacccggttacggttcatcacggcaggctgagcatcgagggggttatcctaagcaagtcc aagacgaggaagggaatagaggagggcaagtacctcggctgggacgacccgaggctcggaacgattagggccctgaggag gcgtggaataaggcccgaggcgataagggagctaatcatcgaggtcggtctgaagagaagtgacaccacagttagctggg acaacctcgctgccataaacagacgcataatagagccgatagcgaaccgctacttcttcgtcgctgacccggttccgatg tacatagagggggccaaggagttcgttgccgagattccgctccatccagaccatccggagaggggcgttaggaggctcaa gttcgtcccaggaaagcctgtctacgtctccagggacgacatggagctcttcaagccggggaacttcgtccgcctgaagg acctcttcaacgtcgaaatccttgaggtgggcgaggacggtattaaggcgaggttccacagtgttgactacgaaactgcc aagaaaaacaggtggaggatggttcactgggtcactgagggcaagccctgcgaggtctgggttccggagggggacgagct aatcatcagaaaggggctccttgaaagcgatgccgacgttaaggttgatgacatcgtccagttcgagcgcttcggcttcg tgagaatagatgaggtaaaagatggaaaggtccgggcgatctttgcccacaag TGATCACTCCGGTCCCTGCGGGACTA TCTTTTCTCCCATTATTCCGAGCAGACCGATGAACAGTGCGAGCACTACTGACGCATAGTAAATGCCACCGAGCTTTATG TCGTGGTGCACCTGCGCTATGAACCCCGCAATGAAGAGTGTCACGGATACCACGAGAACGGCTAGGTCAATTGCGCCGGG TTTTTCCTTGCCGATCACTATCGGATACGCTTCGAAGATAGACGTGAGCAGGAGGGACGTTGTAACGGCCTTGAGGAACA TATCGGCAATGTTGGGCGGGGAGTCGAGGATTCCCAGGACAGTAACTATGCCCATGAAGTAGAGTGCCGCCTTTGACCTG CCGAACTTCATAAGCGATTCCGTTATCTGCACCCCGATCTCGGCCGCGGGTAGGAGGCTGGTTAGTCCGGCCATGAATAT GGTCAGGCCCAGAAAAGCAAGCAACATCGGGTGGTTTGAGAGTATTTCGGGCAGGTCCCCCATAAGGGTTATTG