

>tg1776 Primase-related protein

>tg1776 Primase-related protein

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1716014 - 1718363 (Additional range around tg1776 is :500nt.)

>Thermococcus gammatolerans EJ3 CGATTTTACTCGGCAGGAGAAGCAGCTACCGCCTCTGGCTCTTGCTGAGACCGTGACCCAAAAGCTTTTAACTTCACGAA GTATTGGTGAGCGAGGGCGTTATGTACGCCGAAAACTATAAAAGATTCCTGGAGCTTATAGAGAAACTGCGAGAGTTTGA AGGTGCCCTCATCGTGGAGGGCCTGCGAGACGAGGTGGCTCTGAGGAATCTGGGGGTCAGAGCGGAGATAATAAGGCTAT CACGCTTACCGCTTGCCGAAATCGCTCTCATCGCCTCACGTTACCGGGAGGTCATGATCCTTACTGACTTCGACAGGAAG GGTGAAGAGCTCGCAAAAAAGCTTGTTTCCTATCTCGAGGGCTACCCGTGTCGGGTGGACGTTGAGACGAGAAGGGAACT CAAGCGCATAGCAAAGAAGGACATCAAAGGCGTTGAGGAGCTTTACGGTCTCTACATGAAGGTCGTCTCCGTTTCTGACC CCCAGTTGGAGGGGTTTCA atgaagaggaagaagcacgtcctgcatcagattttgtccgaaaagaggaaggcagaaaga ataaggggtggtaatatgtcagccaaggatgaatttggaacgaccaagtatattatctacgcagaatttgaggcgaacgg tgtcgttgagaggcccgacgttgtcggtgctatttttggacaaaccgaaggccttctcggggatgacctcgacctgaggg aactccagaagaccggaaggatcggcaggattcgcgttgaggttcacacaaaggcaggaaagacctacggaacgataacg gtcccgtcgagccttgacagggtcgaaactgcgatcctcgccgctgcccttgaaaccatcgaccgcgtgggcccggccga ggcccacataaaggttctccgcatcgaggacgtcagggcaaccaagaggaagtacatcatcgagagggccaaggagatac tcgaaaccctcatggaggaggagattccagagacccaggagctcaccgaagaggtcaagaaggccgtccgtgctaaggag cttatagagtatggccctgagaagcttccagctggtccgcacgtcccgttctccgactcgatcatcgtcgtcgagggcag agcggatgttctcaaccttctcaagcacggcataaagaacgcgatagccgttgaaggcacatccattccggaaacaataa tcaagctcagcaaggagagaatagttaccgccttcaccgacggcgaccggggtggagagctcatcctcaaggagctcctc caggtggcagatgtggactatgttgcccgcgccccggagggcaaggaggttgaagagctcaccaagaaggagatagtcaa ggccctgaggagcaagatcccggccgagcaagtcataacggagatgttccacaagggcaagaacttctacgagattctca aagaaaaagaaagaactgcgccctccaaggaggtcaagcccgctccaaagcacgagccaaagccccagcccgtggagcag aagccgagggaagagaaaataatccggcccatccagcaggcaaagagcccggagatagaaaagttcgagaagttcataga gcgcgttaagaaggagcagacggccatactccttgacgagaacatgaacgtcatcgccgagattcctgttagggatctgc tcacgacgatctctaccagggataacatttacgccatagtcttcaacgggataatcactcagaggctcatagacatagtc agcgagaacaacgtccgctacctcgtcggggcgaggaaggccaacgtcgtcagaaggccggtgaacctcaagatactgac ctttgccgag TGATCCTTTCCTTAACTTTAACCTTTATAACCTCCCCGCCTCTTCTTTTTCCGGTGATGTGAATGGTAG AGCGGCTGATCTGGAAGTACGCGCTCATCAACGCCTACACCCACAAGGGTAAGGCAAACCCAAAGGCGGTCATAGGTAAG GTTCTCGGCGAGAACCCGGAGCTGAGGCCGAGGGCAAAGGAGATAATCCCGCTCGTGAACGAGATAGTTGAGAAGGTAAA CGCCCTCTCCCTTGAGGAGCAGGAGGCGAAGCTGAGGGAGATTTACCCCGAATTCTTTGAGGAGAAGAAGGCCAAGAAGG AAGAGAAGAAGGGCCTTCCCCCGCTTCCCAGGGCGGAGAAGGGAAAGGTCGTCACCCGCTTTGCCCCTAACCCCGACGGT GCCTTCCACCTTGGAAACGCGAGGGCCGCTATTCTGAGCCACGAGTACGCGAGGATGTACGACGGCAAGTTCATACTCCG CTTTGACGACACCGACCCCAAGGTAAAACGG