

>tg1828 Bifunctional short chain isoprenyl diphosphate synthase (idsA)

>tg1828 Bifunctional short chain isoprenyl diphosphate synthase (idsA)

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1759147 - 1761175 (Additional range around tg1828 is :500nt.)

>Thermococcus gammatolerans EJ3 AGAAGGTTCTCGCAGAGGTCTCGCAGGCGAGGGAGAACTACCTACTCATCGTCACCGGCCATCAGGGCGAACCGGGAGCT GTGCTAACGCGGATGGCAAACGGAGAGCTCTACGACATTGGAAAGCGCGACACGGTAGTGTTTTCGGCCGGAACGATACC GAATCCCCTCAACAGGGCCCAGCGTTACATCCTCGAAACCAAACTCCGGATGAAGGGCGTGAGAATGATCAAGGACATGC ACGTTTCAGGCCACGCGAGCAGGGAGGATCACCGCTACCTCATAAGGATGCTTAACCCGGAGAACATCGTTCCTGCCCAC GGCGAGTTTCAGATGCTCACACAGTACGCGGAGCTGGCCGAAGAGGAGGGCTACCTCATTGGCAGGGACGTCTTCGTTTC GAGGAACGGCTACACCGTCGAGATTGAATGAAAGGCCAAAAAACTGATAAAGGTTTTCGTCCTTTTTCCCTTCAGCTTTA GATTCAGGTGGGGTGGTAAC atgactgactacaatgaactcttcacgcggatcagaaaactagcaggggatgtcgataa aattatcctcgaactcgttcccgaaaaagaaccaaagaccctttacgatgccgccaggcactatcccctcgccggtggca agagggttcgccccttcgtcgttctgcgggcaacggaggccgtcggtggcgacccagagaaagccctatacccagcggcc gccgtcgagttcatccacaactattcgctggttcacgacgacataatggatatggacgaacttcgcaggggaaggccaac cgtccacaaggtttggggaattaacatggccatcttggctggcgacttactgttctcaaaggccttcgaggcggtagcta aggccaaagtagacccagataagaaggcgagaatccttgaggttctcgtgaagacctccaatgagctctgcgagggtcag gctttggacatagagtttgagacgagggacgaggtaacggttgacgagtacctcaagatgattagcggaaagacaggggc gctcttcgacggctcggcaacgataggtgcaatcgtcgggactgacaatgaggagtacatccaagccctctcgaagtggg gaaggaacgtgggaatcgccttccagatatgggacgacgtgctcgatttaatagccgacgagaagaagctcggaaagccc gtcgggagcgacataaggaagggcaagaagacgctcatagtcagccacttcttccagaacgcaagcgaggatgataaggc cgaattcctcaaagtcttcggcaaatatgcaggagacgccaagggcgacgcgctcattcacgacgagagggtaaaggaag aagtcgagagagccatcgagcttctgaagaagtacggcagcatcgactacgccgctcagtacgccaaggacctcgtgaag gaagccaatgaggcgttaaaggttctccctgagagcgaggctaggagagatttggagcttctggctgagttcttagttga gagggagttc TGATCTTGTCCTTATTTTTGTACTGGAGTTAATGGACGAGTGAGAGTGCCCTTCAGCTTCTTCTCGGGT AGTGGGATACGATCAAGTCCCGGTTTCTCTTCGCTGGTTTACTGTGGTTACTATGTATAAGAAAAATTTATAAACACTTA AACCAGTGGTTCAACGTAAAACAATATTGGGGGTGAGCCTATGAACTGGAAGTTTTTAATTGCAATCTCTTTGGGGTTGT TGATAATAGGATTAGGCCACGCTGGTGCGCTGAGTTCCCCCGATTCTAAACCAGCTCCGTCACTTCCACCGCACAAGGAA AAGCCCAGTCCAACTCCTCCTAGGATAGGGGGAGGAATCGTAGTAAAAACATTCACCGGTTCCTCTAGCATAGCCCAGGC CAAGAGCTTTCTGAACCAGTATTGGGGCAAGCTAACCCTCCGGCTGAACCTCAACGAGTTTCAGAACGTTACTTTTGTTG GGATAGCACTGCGCCCCCTGCCCTCAGGAG