

>tg1829 hypothetical protein TGAM_1829

>tg1829 hypothetical protein TGAM_1829

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1760365 - 1762552 (Additional range around tg1829 is :500nt.)

>Thermococcus gammatolerans EJ3 AGGGCAAGAAGACGCTCATAGTCAGCCACTTCTTCCAGAACGCAAGCGAGGATGATAAGGCCGAATTCCTCAAAGTCTTC GGCAAATATGCAGGAGACGCCAAGGGCGACGCGCTCATTCACGACGAGAGGGTAAAGGAAGAAGTCGAGAGAGCCATCGA GCTTCTGAAGAAGTACGGCAGCATCGACTACGCCGCTCAGTACGCCAAGGACCTCGTGAAGGAAGCCAATGAGGCGTTAA AGGTTCTCCCTGAGAGCGAGGCTAGGAGAGATTTGGAGCTTCTGGCTGAGTTCTTAGTTGAGAGGGAGTTCTGATCTTGT CCTTATTTTTGTACTGGAGTTAATGGACGAGTGAGAGTGCCCTTCAGCTTCTTCTCGGGTAGTGGGATACGATCAAGTCC CGGTTTCTCTTCGCTGGTTTACTGTGGTTACTATGTATAAGAAAAATTTATAAACACTTAAACCAGTGGTTCAACGTAAA ACAATATTGGGGGTGAGCCT atgaactggaagtttttaattgcaatctctttggggttgttgataataggattaggcca cgctggtgcgctgagttcccccgattctaaaccagctccgtcacttccaccgcacaaggaaaagcccagtccaactcctc ctaggatagggggaggaatcgtagtaaaaacattcaccggttcctctagcatagcccaggccaagagctttctgaaccag tattggggcaagctaaccctccggctgaacctcaacgagtttcagaacgttacttttgttgggatagcactgcgccccct gccctcaggagcgtatgcgccgctgtactacttcggacgggtaggggagtgccccgctgaccttctcaagagggcctttt acacagagctcagcgcctttgagaacatcccccttgaggttaagggatccctcgctgacgaacccgggaggaactggaag tacataggtgccgtcaggtcgataaggacatctagggagataagagtaacaacgagcatatggaccgaggaaaaagccac cgtttacaacgagttcggggccgagttttgggtgacctatggaaccagcgggcagtacgtttactacgcctacctgagcc atgagggtaaggtccccacgaaagcatctggaaatcttaaggttgcggtgaagaatgttacagagagcgtaaaggtgctc aactcgaaggatgcgttcattggagtcggaagtttcaggccagagggtagcggctcaacatctcactccactgttacttg gggtctgaacgttggctttggggttgatagcactgggaggcccctgccaaacgcccaggcaggctttaccgagagccact ccacggccctgagcttcaaatggtacaccgacgatgtggatccaaactcggaggtgcatttcaacttctacgatcttgag gagagaggatttatattcagccatccggcatgggggaagatattcattgcccatcccgcggttgtggttcacgttgatcc gggagttacgttccacttggcgaaattgaaactcaaggcagaggccctcttccactatggggcagtcatcgattccccct tcagcggaacctacataacgaggcatgacgtcgaggctccgccaattgagtttacggttgagatgtacccatggttcata aacgaacct TGAGCTCAGCAAGCTCAGCGCTTTGCACTCAGCCATCCCACTGGGGGATGCTCTGCCCCTATCTTCCACT TTTCGTAGACTTCATCCCACTTCCTCAAAAGCTCGGCGCGCTTTTCCTCGTCCTCTATCCGTGCCACGTACTCGCGAGGA ATATATGCGAGGTAGTGTGGCAACTTAGGCTCGAAGGTCCCGCTCCTGATTATTCTACCACCGGCCCGCTCAACGAGCGC CTTGAGCTTCTCAATCGTCGGGTAATGAAGGTCGGACGCGGAAGCGTTCGAGCATTTCAACGTGGAGCCCATCAGAAGGT AAGGGTGGTTCGTTCCGGCGCGGGATTTTTGAAAGGACGTCTTTTTTGAAAGTTTCCTCGCTAACGGGCATGGAAAACAC CAAAAAAGGCCTTCTATTTAAGGTGTTTTCGGAGAAAAGGTCTTATAAGTTGGGGAAAAATTAATGGTAGATTTGAAAAC TTTGTATTTTGCGGTATTTATATCCACCA