

>tg1833 hypothetical protein TGAM_1833

>tg1833 hypothetical protein TGAM_1833

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1765765 - 1767946 (Additional range around tg1833 is :500nt.)

>Thermococcus gammatolerans EJ3 AGACCGTTAGGGAAGCCCAGGAAAAGGCGTTCCGAACCGTCAGGGAGGGAGTAATGGCAAGGGAAGTTGACTCTGCGGCG AGAGAAGCGATCAGCAAAGCTGGTTACGGTGAATACTTTCCCCACAGAACCGGTCATGGACTTGGCCTTGAGGTGCACGA GGAGCCGTACATAGGCCCTGATGGCGACGTTGTGCTCGGAGAGGGTATGACTTTTACGATCGAACCGGGCATCTACGTTC CAGGGCTGGGAGGCGTTAGAATAGAGGATGACGTGGCCGTTGTGGACGGCAGGGGCCGGAGGTTGACCAGATCCGACAGG GAGCTTATCCTTCTTTGATTCCGTCTTATCCGTTTCTTAAAGTTCCTATTTTCAAGATCGCCAGGATATTCCTCTCAAAA CTAGAAAATCCCTCTCACGGGTCTTTAATGTTTTGGAACCCTCGTTTCAAACGTTCTCCACCGGGTTCCTAAAATAGGAG TTCAACGCAGTTCTCAACG gtgatgcccatgagacggtggacggccctcctcctctcggtggtgttggtactgtctata gtgcccttagggcttggctcggcaagcaccacctcccctaccccagcgataacagaacagagcccaacgaacacaacgcc agaagaggagctggcccataggatagtttcgatagttgagcgcctccacaacatgacgtccgtgttggagaacatgagcc tgcccgaaaacgcaaacataatggagaggtaccggctcgccgaggaataccgggtaagaatggaggaagcttacaggagt ggggactaccccgaagcagttacggaaggaatattggcgatgcaccagtataagattgttctccggagcatgaggcagtt cagggagcgggtcagggtttcagttgagcgcgtagaggattacctcaggaacgcgaggaggataataatcaagtgtgatc aggcaggaatgaacaccactcccgcttgggagcttttcaacgagaccagggaggcatacaaactcgtgatgctggatctt aaggagaggaattttacaaaggccgaggaagatctcaaagcggcaaaggatctcaggatgaaacttgacgaagagcttaa acagctcagggaaggtctggcctacacgaacgccgaaaagatagtaaacgggttcctgaagaggggccagaaggccatta ccttcatggaaaacgtactcgcccacatcaacggcactgcccacaacgtgacactactccaggaaaggctatcaaacttc gaggagctctacgacagagtcaaggagatgagcgaggcaggcaactacactggggcagtgacactcctgttcgaggagag gaagaccatcagggagtttcaaattaccgttaaacatgtcctaaagaaagccagggagaagaaaatcaaggaaaagctca aagatctcagggcgtttgggaaggaaattcgggagcggctcaaagaggcaaccaagggcctggaaaaactcaagcgtaaa ggcatcaatacaagaggagctgagatcaagctaaaggcggcagctcaggaattcagagctggttttgaattggccaagag aagagacccaagcgcaaaggttcacatagagctcggcctcaagctgctccacgaggttgaggatttcatagtcaggaacc tc TGATTTTCTCTTTTTTCTCCAAAAACCTTAAATACCCAAAGCCGTTACTCGCACCGATGCCGATGAGGGGGGAGTGT CTTCTCCGCTGGAATCACATCGGTGTCTGATTTTACCGATAACCCCCCTATTCTGGACTCCCGCTCTTTTGGAAAAACCT TGAGGAGGTTTGGACATGAAAGTAGACTTCAAGGCCATTGAGGAGAAGTGGCAGAAGCGCTGGCTTGAGGAGAGGGTTTT CGAGCCCGACAGGAAGGCGAAGCCCAAGGAGAAGAAGTTCTACATCACCGTCGCCTTCCCGTACCTTTCAGGCCACCTCC ACGTCGGCCACGCGAGAACCTACACGATTCCCGACGTCATAGCGCGCTTTAAGCGCATGCAGGGCTACAACGTGCTGTTT CCAATGGCCTGGCACATCACAGGGGCTCCGATAGTGGGCATAGCAGAGCGCATAAAGAACCGCGACCCCAAAACCATACA CATCTACCGCGACGTCTACAAGG