

>tg1841 Cell division GTPase, ftsZ-like protein (ftsZ)

>tg1841 Cell division GTPase, ftsZ-like protein (ftsZ)

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1771911 - 1774161 (Additional range around tg1841 is :500nt.)

>Thermococcus gammatolerans EJ3 CGATCTGCACGTCTCCTCCAATCTTGGGGACGATCTTTTCAGCCTCCCTCACTTTCACTGCTATTACCTCGAAACCCCCC ATTGTCCTCCCCCGCCATCCATACGGGGCTCCACTTATAACGGTTGTCGCCTCCAGCTGAGGGTATCCAAAATATTTATT GTATTTCTAAATTTTTTCTAAATTTTTTCGTGATTTTTAATATGTCAATATTATTAACAAGGCGCAAAGTATTTAACTAC TTAAAGCACTAACTAAAGTAGCGACCCACTGCCATGGGTGGTACAGCGTATGACAAAGATGCGCATCATAAGCGTTCAAG TGCCCCAGAGTTTTGTTAACGCCATGGACCAGCTCGTCAGACGCGGTGTTTACCCCAACAGAAGCGAGGTTATCAGAGCC GCACTCAGGGAGTTCCTCAAAAAAGAAATGAGCACCGAGCTACAAGGGGACGAGGTTCCTGAATATATAATCAAATAACT CCGGAGAGGGGGTAAGGAAT atggtgtttaagctcctggagcaggccggaataaaactggaccttgatgagggcaagga agtggagaaaaaagcggacttttttggcgaggattttgacgacttcatcaaaatagccatcgttggtgttggtggttcag gtaacaacactataaccagactctatgagctcggagttgagggggccgagcttatagccatgaacaccgacgcccagcat ttggcgagggtgaaggcccataaaaagctccttcttggaagggagataactcacggaaagggttccggcggagacccaag gataggatacaaagccgccgaagcaagcgcccacgagatagcaaagacagttggcgacgtggatctcgtcttcataacgg ctgggatgggtaacggaaccggtaccggtgctgcccctgtcgtggcaaaggtaataaaggaacacgctaggaacagcggg cgcttccgtgagcccttggttgtaagcgttgtaacgtttcccttcaagaccgagggaacggttcgcctcgaaaaggcccg cgccgggattaaggctctcctccagtactcggacactgtgataatcatcgagaacgacaagctccttaaactcgtcccca acctgccgataagcgcagccttccgcttcgccgatgagataatagccagaatggtcaaagggataaccgaaacgataaag cttccgtccatggtgaacattgatttcgccgacgtttacagcgttatgaaggacggtggggctgcactcataggtatagg ggagagcgactctaagaagagggccgttgaggccgtcaaggctgccctcgagaacaagatgctcgatgtcaagttcggta gcggtaacaaagcacttgtccactttaccgtcggtcctgacgtgaacctcggtgagatcaacgaggcgatggaagttgtg tacaacaacctcggagccaagtccgagatcaagtggggtgcccgcgtcgatgaggacatgggtaaagtggtcagggcaat ggtaataatgaccggcgttgaaagcccacacatactgggtggtgagactgcattaatagcaaagtcggactcagttgtaa tccccgagcctgagccgttccccttcgcggagaaatcgaagtcctcgaaagacctctacgccataatcgcgggcaaagag aagccctctgccaagatcgatgacgagcgcaagaagatcattgaaaagatactctccggcatcgacgagttt TGATCAA TTCTTTTATTTAATTGCATAAGGTTTTTATCTTTTGAATTCCAAACCTGACCGGTTAAACTTAGAGAGCGGGTGGTAGTA TGGCCGTTGTAATCAGTGTGGCCAACCAGAAGGGAGGAGTTGGAAAGACGACCCTCACCATGAACCTCGGCTACGGCCTC GCAAGGGCCGGTAAAAGGGTTCTTCTCATCGACGTTGATCCACAGTTCAACCTCACTTTCGGCCTTATCGGCATGGACGT CCTCAAGTACGGGAACAACAACGTTGGAACCCTGATGAGCCGGGAGAGCAGCGTTGAAGATGCGATAGTCGAAGTGACTC CAAACCTGCATCTCATACCGAGCCACCTCAACCTCTCGGCCAAGGAAATCGAGATAATTAACGCCTACAACCGCGAAAGA CGGCTTGTAAAGGCGATAGCGCCGGTTCTACCCGACTACGACTATGTTCTAATAGACAATCCTCCGAGCATGGGCATCTT TCTCGTGAACTC