

>tg1852 ABC-type transport system, ATPase component, putative maltose/maltodextrin transporter (malK)

>tg1852 ABC-type transport system, ATPase component, putative maltose/maltodextrin transporter (malK)

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1781425 - 1783510 (Additional range around tg1852 is :500nt.)

>Thermococcus gammatolerans EJ3 GGGCGTGGCCCTGATCGTGGGCGTTTACCTGCTCTATCGCCTGACTTTCCCAGCTAGCACGACCGCAGTGGGGCTGTACT CATTCGTTTACGTTATACTGGCCCGGGCTGCCCTTGAGGTTCCCATGTCCACATGGCTCATGAAGGGCTTCTTTGACACT ATTCCCTGGGAGTTCGAGTGGTCCGGGATAATCGACGGGGCTTCGAGGATAACCGTCTGGAGGAAGATAATGCTCCCCCT GATCAAGCCGGGTATCCTGGCAGTTGCTCTCTTCGCGTTCTTGGCCGGCTGGCAGGACATAATCTACGTAAGAACCTTCC TCATCGACCCCACACTGGCGACGTTCATAGAGTCCAACATAGAGGCCGAGTACTCCCACATGCCCCTCATAGCGGCCGCC GGGACGTTCTACCTCCTCCCCACGATAATATTCTTCATAACCGCCCAGCAGCTCCTCCTCCAGGGCTACTCGGGTGGAAT AAAGGGCTGAGGTGGTTGAA atggttaaggtcaccctggataacatcacgaagaggttcggcgactttgaggccctcaa gcgggtaagccttgagatagccgacaaggagtttatggcgctcctcggcccctcgggaagcgggaaatccactctcctct acacaatagcgggaatttacaagccgacaagcgggaggatatacttcgacgacagggacgttacggatgtccctccaaag gacaggaacgttggactggtcttccagaactgggcgctctatccccatatgaaggtcttcgacaacatagccttccccct tgagctgaggaaagttccaaaggatgagatatccaaaaaggtcaaaaaagtcgcggagatgctccacatagagaaccttc ttgaccgctacccctggcagctctccgggggccagcagcagcgtgtcgcaattgcgagggcccttgtgaaagagccggac gttttgctcctcgacgagccgctcagcaacctcgacgcactccttaggcttgaggtaagggcagagctcaagaggcttca gaaggagctcggaatcacagcagtttacgtcacccatgatcaagccgaggcccttgcaatggccgacaggatagccgtga taaggggaggcgagatactccaggtcggagatccggatgaagtctattacaagcccaagtaccgcttcgttggtggcttt ctaggaagcccgccgatgaacttcgttgaggcagaagtccaggactcctacctcgacgtctatggcaacaagattccaat cccgccccagtaccgcgagctggtgaagaaactcggcattagggaagttatccttggcttcaggccacacgatgccgagg tcgtgaaaggaaaggcagaggggctcttcgggactgtttattcctttgaacccctcggtagagagcagataattacggtc tcagtcaacggagcgtccgttaaagtctttgctccagagggagagcacttcacattcggcgagcaagttactgtgaaact cagggaggacaggataatcctcttcgacaagaaaacggaaaaggctcttgagttcctgctggaggag TGAGCTCATCTT TTCTTTCTTCCAACCATCCACACAGTCAGTGCCACCCTTATGTTCGTGAGTACTGCAAGCAGGAGAAACAGCGCTTTGAC TAAAGCCTCCATTGGATACAGCAGGAACAGCATCGTAAGGAAGATTCTCTCGTCTCTCTTGCCCGGGAGCTTTCTGAGGG CAGGAACTTCCCGATAGGCGTCCCTGCAGAAGGCTCCCTTAAAGCGCTCCGTTGAGTAGCTCACCATGACCGAACCGAGC AAAGCTAAGAGCGCGACCAGATACCAGAGGGGTTCCTTCAACGTCGAGTAGGCCAAGAGGGCTAAGAAAGTCCCATCAAC GTAGCGGTCGAGGATTGAATCTACGTAGCCACCGAGCCTGCTCGTCCTCAGCTGGGCCCTCGCAAGCTCGCCGTCAACGC CGTCGAGGATTGAGCTCAGCTGGTAGAGGATTCCCGCTAGGGGCAGGCTGATGAGCGTTAGGAAAGCCGAGAGCACGCCG AGGGCGA