

>tg1859 hypothetical protein TGAM_1859

>tg1859 hypothetical protein TGAM_1859

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1790618 - 1793066 (Additional range around tg1859 is :500nt.)

>Thermococcus gammatolerans EJ3 AGCCTAACCCCGATGGAGTTCTTTTCCTTCGTGGGGAGCATAAGGGGGATTCCAAGGACAGACTTAGAGGAGCGCGTCGA GAGGCTCGGGAGGGCCTTTGGAATCGAGGAGTACCTCGGCGAGCTGATAGGGACGCTCAGCTTCGGAACCCAGCAGAAGG TTTCGATAATAGCCGGTTTGCTCCACGACCCAAAGGCCCTAATCCTCGACGAGGCCATCAACGGCCTCGACCCCAAGAGC GCACGCATAATGAAGGAGCTCCTCAACGGCTTCAAGGAAGAGGGGAGGAGCATCGTCTTCTCAACGCACATCCTGGCAAT AGCAGAGGCAATTTGCGACAGGATAGGCATAATCTACAACGGCGAGCTAATAGCGGAGGGAACTCCCGAGGAGCTCAAGC GCTTCGCCCACGAGGAGAGCCTTGAGGACGTTTTCCTCAAGCTGACCGAGAGCCAGGAGGAGGTAAGCTCCCTCGTCAGG GCCCTAAGGGAGGCCTTCTG atggagcgggaaatcgtaaacgtcctctaccgcgagatgacctacaaaaggctgaaggc caatccacagctatcagcggactggaataagttcctcaaaaccttcaagaggagcggaagcctcaagagaaccctactga gccagtcaatcctcttcagttttctcggcctcatactgctcccctccgtctactacgtcaaaactgatggctcggcggta gtttacgcgagctactgcatgctccctctgattgttgcactctacggaacggccgttactgcacagtatgcggtctctct tggcctctttgagccactcctctcactcccggttcgtgttggagggaagtacctaagtgccctgctcctcataacggaac tgccctctaccctcctcctcttcccaccagcgattgccctatccctgaagctcgggcccgttgctggaaccctcggcttc gcttgggcgctgatgggagcttttataggccacaccctgggcttgctcatctacgaccgcctcggaaagacctccggtgg aaggttttcgggcctaaagacggcctttaaagcctttgggataatcctcgtgatgtccctcttctacggcatgaactaca tccagcgctacgtctcaagccattatgaagccctcaggggagttttcgagaagtactccatagcctatcccttctccgtc gtcaccgtcgagaagcccctcctctcgctcggcctcctagccgtttacggccttgtgattggagcggtctacgtttcaac cgtcagaaggctctggagaaggataagcgaggggacaacggttgagagaaggggaggaaaagccaaactctcgctccaca gcccggccttggcgctggcgctcaaggacttcaagatagcctcgcggaatacgtcactgctgacgggactgttgatgccg gtcgtggtcataatcccatccctcgccggtgcgttgaagtcgggaagcgagggctctgccctcggctttgttttagcgat tggctggacgtcttcgatagcgatagacgcggttttaaagatagatgggagggcctttgaagtccttcactcgctcccgc tgagcccgaggacgtttctgcggggcaagcttgtgacgatgacggttgttcccgtgacggcgggcctgggtgctgttttg ggactctcgctggggaacccgagtgtggtgaaggttctacccatagccctcctcctgccggtcgcgaccgctggaacgac tctgacggtcttttactggggaattcgcgaggttgcactgccggagacgagatgggaaaagatgctccttgtcctgcttg cgaacggtataataatcggagttacagctggactgtggtacgttgagtgcttcctctcgattcccttcgttgccatcgtt gacgcactgttgctctggcacctcagcagg TGACGTGGAAGATTCCGAGAACCTTTCTCTTTCCGCTTAGTTCGTTGAA GAACTCCACTGCCTCTCCCGTAGGGAGCTCATACACTTCTTTGTCCCTGACCAGCTCCCTGGTCTCGGGGAGAAGCGAGA GATAGCCGTAGTAGCCGGTGCCGACGATTAGAACCTCAAAGTCCTCCGTCAAGTACTCCCTCAGCTCGTCGGGGTCGAGT TTGTGGCTCGTTCCGTGCTTGGACTTGCTCAGCCACTTCTTCCTCTTCTCGACCCTTCCGCTCGGATAAACGACTACATC GTGCTCGTATGTTTTGCCATCGACGATGATCTTCCCAAAGGAGGGGTATTCGAGTTTCATAGCGCTCACCAGCAATCCTT TGGGTGGAGCGCGTCCCTCAAAATCTTTGCGTGGTCAAAGGCCAGCGGAAGCTTCTCTGCCTCTTCAATCGGGACGACAT GGACTTCCTTCGCATCGTCGCCTGCCTTCAGCTCTCCCTCGCCGATGCAG