

>tg1894 TRAP transporter, 4TM/12TM fusion protein

>tg1894 TRAP transporter, 4TM/12TM fusion protein

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1817870 - 1821164 (Additional range around tg1894 is :500nt.)

>Thermococcus gammatolerans EJ3 GAAGGGCCTTCAGATTCCCGACGACCTTAAACCGCCCAGCGGGTGAGGGTAGTTGAAAAAGTTTCTTTTCTTTTTTGTCC TTTCAATCATCCCTATTTTCCTGCTTCCAGTTAACTGTCTCGTCATAAGCGACGGTAACCACGAGCGGGTTTATTCCCTG GGTGTTCACAACGTTACCATCCGTTACATCCATAGCGTTGAGAGGAGCACTGTGATAGAGGTCCTTCAGGTAAACTCCAG CGGAATTTACGCCAGGGAGATGTGGTGGAAGGATTTCGGGGCGGGCCTTCCCGAAGACATACAGTTCATGAAAGACGGGT TTTACGTCAAGAAAATAGAGATTCCCCTCGGGAAGAGCCTAGACTTCTGGTTTATCCCCCTAAACCGGGCCAGGATATAC GTCGATGGTAACTTGGTGCTCCAGCCAAAGTCAGAGGTGCTCGTTCACTTCCGTGTGGAAAGATGCATGCTGATTCAGAA AGCTGTTGGGAGGTGTTAAT atggttgagaacaaagagattccggttgaaaaggccgaagttattattgagagaaccag aaagctccccccaatccttgaaaaggtcataacagctgccgcgatactaatcggtatttatgaaatcctgttcatattta acttcaactacacactctacgatatgttctcccgcatgggaataaagatgggcttcctgaagacgacatttcaaacgaag cagggtgaagccttcgttatggccatgatcctccttatcacatacctcctgtatcccgttaaaaaggacagaaagcacct cgaaaaggtgcagttctacgattacatactggcggccctaggtgttgtgtccgcgttctatctgttcattgtgtacccga ggtacaccgaattcgcggacgtctatatgagggacgttttcttcgggatcctggctataatcctcgttcttgaggccacg agaagggtcctggggtgggttctccccctcgttgttacggtgttcctcgtgtacggtatctacaacataaacttcgactg gattcgcttcacccagcaactctactttgatgagggaatctttggcattcccttctttgttatgaccatatacgtcttcg ccttcgtgttcttcggtgcgttcctgctcaagataggcatcagtgattacataacggagtttatgataactctcttcggt aagagacctggcgggccggcaaaggcagccgtcgtggcaagtggtctcatgggcacggtgagtggatcgagcgtcgccaa cgtcctcacaaccggcacctttaccatccccctgatgaaaaaggccggttatccccccgagatagccggtgccgttgagc cggtggcgtcaacgggcggtcagctgatgccgccgataatgggtgcggccgcgttcataatggccgagttccttggcgtg ccctacaacaagctcataatcgccgctgtcataccggcactggtctactactccggagtttaccttttcattgatctcga aaccaagaggctcggcctcaagggaatgcctacggagcaatttgcaccgctgaggtactttattcggaagctctatatcc tcctgcccatagtggtcataacagttgccctcgtctggggaatcgctccacacatatcggcaatatcttcactcggcgtt gccatctgggtcgcctggatttccaaggacaggatcaaaggacacgaggggctgtacgttgcagtggttttgataacaat acttctcatgttcaccggcaaagcaatatctacccccgttgcaggggttctggttctcttgggcctcgccctgatagcta tggcctacctcaccgatctggttgagttcaacgaaaagctctacatcagcctgctcttcatattcttcattgccctcgtc aaatacctcgagatgaacaaagagcagatactcctgctcagcggtgtcatgggaatagtcttctcgatgatcgtgggtta tatctccaagagcgaggaaggcaaggagatgtaccgggcgacgtatgaatcgatgatcgacgcgggcaggaccagcacga gcgttatgcttgcagccgccagcgcgggacttatccagggtgtcctaacgatgaccggtctcatcacgagccttggctac cggctcgttgaccttactgcgggcaacctgtggctactcctcattctgacgatggtgttcagcctcatactcggaatggg cgtgcccacgacggccaactacatcataacatcgctggtcgccgctccggcaatctacaacgcggtctcaaacattcagc cctacaacctcaacgttcccggctacggaacaagtatagccctccttgcggcccacttcttcgtgttctacttcggaatc cttgccgatgtcactccgccggtggcactggcaagctacgctggttccgccctggcagggggtgaattctggaagacggc aatgaacgccgtcaagtacgcgctggcggggtacataggaccgtacatatacttcacccatccggagatgttcatcataa ccgtccaggattggacggtaaagaccgcactaacggtcgtctacgacttcggggcaacgctgctcgtcatgtacctgctg gcgatagcccttacagggtggtttggaaagcacataagaaaagaactgagggctcttgcgggagtagtgggcctgctctc ggcatccctgcacccaatacccgttgccataggcgccgctacggtactcttcctgaagttcctcggccgagagctc TGA TTTCTTTTCTGCTTTTCTATTCTCTTTACAGTGCAGTTTGGGAAAAGATAAAGGGTCAGTACAGCATGACCTCGAAGCCG AGCTCACTCAGCAGATCCGCAAGCTCCTCGCTGTCAACGTAAGCCAGAAGGTGGTGATTCCCTATCGTCCCGTCCACGAA GTCCTTCGCCTCTTCCACCCTGAGCCTGACCTGCGTTCTGCACCGGTTCTCACTCCTCTCAGTCCCGACTACCTCAACAC CCGCCACGATGGCCTTTCTTCCACGTACCTTCAAAAGCGAGGCCTTTCCCCGGGGCATCTCCACGGCAACGCCGACACCC GTTCCGCTTTCAAAGTGAGTTCTGAGAACGTATCCCCCCAGCAGAGGAGCCGTGCAGTGGGCTAGGATAAGGTAGTCGTC ACCGTAGTCCGCGATATTTCCCATAAAGGCAGGTTTGTCGAAGAACTTTCTGACGAGCAGCATGCCGAGCAGTGAATTCA GCTCGCCCTCGCAGGC