

>tg1895 hypothetical protein TGAM_1895

>tg1895 hypothetical protein TGAM_1895

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1820226 - 1822431 (Additional range around tg1895 is :500nt.)

>Thermococcus gammatolerans EJ3 CCCCTCGATCTTACCTTTGACCTTTTCGACGTCCACGCTCCCCTCAACGTATATCGCCATCTTCGGCTGCTGGGTTTCCT CGTCGTACCCTCTCACAGCGAAGATGGCCCTCGATAGTGTCGCTATGTCCACACCCGTCTCGTTCAGAACGTTCTCCCTT AGGGACTCGTACTTGGGGTAGAGACTGAGGTTCTTCATAAGCTCCTCAAAGGCGGCCTCTTTTACCGTGCTCATGTCGAA AACGCCCGCCACTATCGCGTCCGATGGAACCAGCTCAAGCCAGCTTTTCTCCCTGCTCCCCCCAATACATCCGCTGGAAG CAATCCCAGCAATAAGAACAAAGAGAATTATCGCCGCATAGATTGTCCTCCCCTTCATGGGGATTCCCCCATCAAAATGT TGGATCGCTTTTTATTTATACCTTTCCACAGGAGGTTAGAAAGAAAGGTTCATAAGTGCTGAAGCCGAAGATCGCTGACC CAAGGGGAGGGATGGTAGC gtgaaggttggtgtcatcttcggagttagcgaactcgcggatcccaaggcgtttgagagg aaagcctctgagttcctcaactgcctcgcgagggaacacgagataatgggcggcctttttgtatcgaccaagtccgactt caagagggtcaaagaggaagttgatctaaataaagcggacgttctggtgctctatcctctaactgggggaactgagaacg ggctaaaagagtttgcagtttacagaaaaccgatcataatatacggtgatcccttcaacaattctatcgccgccggtatt gaactgagggagtacttcagggaaaggctcattccggccaccctcgttaaggaaaaagacgagttgaaggcggctttact cgggtacgaagactcggcggagctttttgagaagtttctccgggttcgtcttggtctgatcggcagggtgtcaccgtggc tcatcaacgaacgattcgagctaccctacgtccacataagtctgaagaagttctacgagtattacgaagacaccaacgag gaagaaggtcttgaagtgatagagaaaatcgttgagaatgcacgtgagataaaagaacccgacaggaagtcccttgcaaa ggcggggcgggtttaccttgccctcaaaaaaataatcggggactacaaactggacggcttcacaatcggctgcttcgacc tcatcggaaagatcggaacaacaccctgcctggccctggcgattttcaacacggaggggattcccgcggcctgcgagggc gagctgaattcactgctcggcatgctgctcgtcagaaagttcttcgacaaacctgcctttatgggaaatatcgcggacta cggtgacgactaccttatcctagcccactgcacggctcctctgctggggggatacgttctcagaactcactttgaaagcg gaacgggtgtcggcgttgccgtggagatgccccggggaaaggcctcgcttttgaaggtacgtggaagaaaggccatcgtg gcgggtgttgaggtagtcgggactgagaggagtgagaaccggtgcagaacgcaggtcaggctcagggtggaagaggcgaa ggacttcgtggacgggacgatagggaatcaccaccttctggcttacgttgacagcgaggagcttgcggatctgctgagtg agctcggcttcgaggtcatgctgtac TGACCCTTTATCTTTTCCCAAACTGCACTGTAAAGAGAATAGAAAAGCAGAAA AGAAATCAGAGCTCTCGGCCGAGGAACTTCAGGAAGAGTACCGTAGCGGCGCCTATGGCAACGGGTATTGGGTGCAGGGA TGCCGAGAGCAGGCCCACTACTCCCGCAAGAGCCCTCAGTTCTTTTCTTATGTGCTTTCCAAACCACCCTGTAAGGGCTA TCGCCAGCAGGTACATGACGAGCAGCGTTGCCCCGAAGTCGTAGACGACCGTTAGTGCGGTCTTTACCGTCCAATCCTGG ACGGTTATGATGAACATCTCCGGATGGGTGAAGTATATGTACGGTCCTATGTACCCCGCCAGCGCGTACTTGACGGCGTT CATTGCCGTCTTCCAGAATTCACCCCCTGCCAGGGCGGAACCAGCGTAGCTTGCCAGTGCCACCGGCGGAGTGACATCGG CAAGGATTCCGAAGTAGAACACGAAGAAGTGGGCCGCAAGGAGGGCT