

>tg1898 23S rRNA (uracil-5-)-methyltransferase (rumA)

>tg1898 23S rRNA (uracil-5-)-methyltransferase (rumA)

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1823063 - 1825325 (Additional range around tg1898 is :500nt.)

>Thermococcus gammatolerans EJ3 TGAATCCCTGGGGGCAAGAATAGCGGCCATAGCGGTCGTGGTGGACAGGGAGGAAGGGGCAGAGGGGAGTATAACCTCAA AGGGCTACACTTTCCTGCCCGTTATCAGGGTCTCTGAGCTCCTTGAAAGAAAAGAAACAGTCAAAGGGCGGGAATCGGAT TAGAGGGAGGGATTAAACGTAGTCCTCAAGGGTTTTGGCCTTGACCATGATGTTTGCCTTTTCCCGGCCGTAGAACACCT CAACTAGGCCGTCGGACTCAAGTTTCTTCACCGTCGAGAGAAGTGCCGGCATCGGGGTTTCGAGTTCCGAACTCAGGTGC TGGAGGGCAACGGCCCTCTTTTTTGTTGCCAGAACCTTATAAACGAAATCCTTGCTCCTACCGAGCATGGGAAGAGCACC GATAATAGTTATCGCTCCACGTAAATAAACTTTTCTGGACAAAAATCGTCACCGCGACGGGCCAAGGGTTTATAAACCAA AACCCGCTAGAGGGCTCCA atgacgattgaaggaaccgttagggagctcaacgaggacggccttgggattgtgaaggtg ggccggaggagggtacttgtcccgttctcggctccgggagacagggttaggatagagagaacgagaaagaaaaagaggaa gatcatcgcggagaggtttgagatcctcgagccctccccagttagaaaagagccccaatgcgagtactttggacggtgcg gtggctgtctgcttcagcatctggactaccgggatcagctcgagttcaagaggttcaagcttaacgcgatcctgaatgaa gatgtcgagattataccatcaccgaagatatttgggcatagaaacagaattgatgttgtcatttcgacaaggggtatcgg gttcagaagatacggcacatggtgggacgttgtggatatcgagtggtgccccgtcttcggcccatcctcaaagagggttt tgaagtccctccgagagttcatagaggatcatgaagtgagcctctacgaaattggaaaaaacgagggacttctgaggtat atcgtgatccgggaggggaagtttaccggggacctcatggtgaaccttgtgaccggccctggagagcttccagaagactt tccccagtactttgactacgcggagtcaatatactggagcgttaacagaacgcccagtgatgtctcctacggtgaaattg agaggttctggggcaaggagttcataaaggaggaacttgacggaaccgtttaccttattcatccaaacagcttcttccag accaacagctacggggccgttgaactgctacgtgaggtggcgaagagggctgaagggggcagggttctggatctatactc cggtgtcggcacatttggggtctatctagccaggaaaggattttccgttgagggtatagagatcaatcccttcgcggttg agatggccaatcgaaatgccgagataaacggggtggaggcgaggttcagggtcggtgccgacaaggacgtagggagcctt caggcgtacgacacagtaatcgtcgatccccccagggcaggtttgcatccaaaacttgtaaaacggctcgtccaaaaagg gcctgaaaaactcatctacgtttcctgcaatcccaagaccctcgcccgtgaccttaatgaacttaagagtgtctacaccg tagggggtataataggtcttgacatgttcccccacacaccacacgttgaggtggtggttgagctaagacgtcagagattc aat TGAAGAACCGCTAAGTTAATAAATCATAACATCCTAGTTCGATATTAGGTAGGAGGTGAAAAAGTTGCTCGACGAG AGGGACAAGATAATAATCGAGATGCTTACCAAGGATGCAAGAACGCCCTTCACAGAGATAGCCAAAGTGCTGGGCATAAG CGAGACTGCCGTTAGGAAGCGTGTAAGGGCTCTTGAAGAGGCAGGGGTTATAAAGCAGTACACGATCGTCATCGACCCGT CAAAGCTCGGCTACAACCTCGTGAGTTTAACTGGGATCGACACGCTCCCAGAGAAAATATTCGAGGTCGCCAGCAAGCTC AAGGAGTTCGAGTTTGTGAGGAGCGTCTACCTCACGAGCGGGGATCACATGATAATGGCGGAGGTATGGGCCAAGGACGG CAACGATCTCTCCGACATCATCTCTAACAAGATTGGAAAGATCGACGGTGTCGTTAAAGTCTGCCCGGCGATAATCCTAG AGCGGTTGAAATGACCTTTTCATT