

>tg1908 hypothetical protein TGAM_1908

>tg1908 hypothetical protein TGAM_1908

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1831289 - 1833431 (Additional range around tg1908 is :500nt.)

>Thermococcus gammatolerans EJ3 TGAGGTCGCCCTTGAAGGCCGGGTACCACGTGTAAACCTTGACGTCGTCGCTGAAGTAGTCGAGTATAACCGAGGGAGCG CGCTTGGCGCCGAGCTTCTGGAGGCCGGCCCAGCGGTGGTGGCCGTCAACGATGAGGTACTCGTCCGTCCCCGGGATCTT CGCGAGGAGCATCGGCTTCCAGAAGATGCCACTTCCCGTGACACTCTCGATGAAATCCTCAAGCTCCTTCTGAACGAGCT GCTCGTGAGGCTTCATCTTGTCGAGCTCGATAAAAACGTAGTCCACTTTAACAGTCGGGATGTCGTACTTCGGGACCTTT TCAACTCCCATTTCCAACCCTCCGTGAGATCAAAACCTGCAGACCGATATCGAATTGAGGGATAAAAAGGCTTTCCTTTC CATTTGACTACATTTTTCCGGTAGACCTGCACTTTTTGATTGGATGTGCGAAGATCATGCGGGACAACCGTTAAAACATC TGAGCGAGTATTACCGGAGG atgaggaacgttgcggaactgcccctccacggcggccacgttcccgcgtggcttgccca aagaatgaggaagctaacgaaactagtgctaatactcgccgttgacgagtacgggacgaagggtctccttgagaggctct ccgaccctatctggttccaggccttcaacaacctcatcggcatggactgggactcctccggtagcacaacggtaacggtt gggatgataaaggacgccctttccaaggaggagctcggggttaaggtagccggcggtaaagggagggcaagcaggaaaac accggaggagttaagagccatagcggagcactacggactcgacccggaaccttacatcagaacgtccaggctcgtcgcga aggtcgacaccgtcgccttccagacaggttaccagctctaccaccacgccttcctcctcgacgaggagggcaattgggcg gtgatacagcaggggatgaacgaaagggccaagcttgcaaggcgctaccactggttcaacaccgagacctttaccatcga tccccacaaggcgatagcgggcattagggccaaaattgccctcaatactgtctcaaaagactccagggaatttcaaaaga cccttctcgatatcgtgagtgagaggcccgagaaaattgaacgggaatttgaaaccataaaggccatagcgaagggctac cgtccattggtctactatcgcccgaggaacgtcgatgaggtaaccgttctgaggcgttacgaaagccttggaaaactgga gctcaacaggaaggcacttgaattcgcgagggaactgggggttaggaactatgaggagcttctactcctcaagggcctag gtccgagcacgctcagggcactatcgctagttgtggagctggtctacgagacgccacccagctggagggacagggttacc catccggtcgatcctttcaagttcacctacgcggtcggcggaaaggaccgcgtgccgttcccagttgagaagagaaccta cgatgagctcgtctccttccttgaaaagttggtcgagaagaaccgagatgagagaacgctgatcagaaacgttgccagga tcacgaaaaactggaagtttccagaggaagagaaaaggcccacc TAAGGCCCGAAGGGAGAGCGAACGCAAAGCAACGA GCCCTGGGGCACGTTTAGTTCCCTCGCTATCGGCCGGCACTTGGCCTTCAGGAGGTAGAAAATCCTCCCATCTTTCCTCT CGCTCAGGGTCTCAAAGTTCCCCTGTCCCTTGGCTATTATTACGTCCGCCTTCTCGAAGACCTCCATGAACTCCCGAGAA ACAAGGCCAAAGGGCACACCGACTATTCTCGTCCCAGTCGAGATTACCTCGCCAATCTCCTCAAGGCCCGCTCGCCTGAG ATCCTCAACGGTGGCGTCGTTTATTATCGGTCCCTCCTTGCCGGCGATGTAGATCTTCAATTGGGGAAACTCTTCCCGAA TCTTCCTGAGGAACAGCCTGTCGAAATATATCTCGCCGCAGTTGTCCGTGAGGTAGAGGAGGATCTTTGCCCTACTCAGC CTATTGAAGAGTTCATCGGAGTTGTCGATGTAGAGCTCTTCCCCGAGCATTGCCCTAACGTCCT