

>tg1924 DNA-directed RNA polymerase subunit A′ (rpoA2)

>tg1924 DNA-directed RNA polymerase subunit A′ (rpoA2)

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1845344 - 1847516 (Additional range around tg1924 is :500nt.)

>Thermococcus gammatolerans EJ3 GTATGAACAACCACGCCGTTATAATGGCCAAGACCGGGGCTAGGGGTAAGATACTCAACATAACCCAGATGGCAGCGATG CTCGGCCAGCAGTCGATTCGTGGTAAGAGGCTCTACCGCGGTTACCGTGGAAGGGTTCTGACGCACTTCAAGCCGGGTGA TCTGGGAGCGAGGGCAAGGGGCTTCGTCGTGAACTCCTACAAGAGTGGCTTGACTCCACAGGAGTACTTCTTCCACGCGA TGGGCGGTAGAGAGGGACTCGTCGATACTGCCGTCAGGACTGCACAGAGCGGTTACATGCAGAGAAGGTTGATCAACGCG CTCCAGGATCTCAAAGTGGACTACGACGGAACGGTTAGAGACCCGACCGGAATCATCGTCCAGTTCCGCTATGGGGAGGA CGGCGTTGATCCAATGAGGAGCTGGCAGGGCAGGACGCTCGATGTGGAGAGGATAATAGTTAGAAACCTGCTCAAATCGA GGGGCGGGAGGTGATTGAC atggtagccgcgaagaccattaaaacccttgtctggaagtccgagcttccggacaacatc aaagaagagctctacaacaagctcatcgagtacaacaagaagtacaagctcaagaaggccgaggttgaggccatcataga agatgccgtgaacgagtacaggaaggctctcgtcgaaccgggcgagccgataggaaccgttgcggcccagtcgataggag agccctcaacccagatgaccctcaacaccttccactacgcaggtgtcgctgaaatcaacgttaccctcggtctcccgagg atcatcgagatagtcgacgcgaggaagaacccctccaccccggttatgacggtcttcctcgatgaagagcaccgttatga tcttgaaaaggcgagggaagtcgcgaggagaatcgaggggaccacgatagagaaccttgcgagggagatgagcatagaca tcctcaacttcgagttcatcgttgagattgaccccgagaggctcgagaagagcgggctcgacatggagaggattctcaag aagctgtccggttcgttcaagagcgctgagttcgaggcggaggggtactcactcatagtaaggccgaagaaggtaacgaa gctctcagacctcagaaagctcgccgaaaaggttaaaaagcaccgccttaaaggcctgtctggcgtcggaaagaccatca taaggaaggaaggcgacgagtacgtcatctacactgaaggctcgaacttcaagcaggtgctgaaagttccgggcgtcgat ccaacgagaacgagaacgaacaacatctgggaaatagcggacgtccttggcatagaagccgctcgcaacgccatcatcga ggaaatcgttaacacgatgcgcgagcagggtctcgaggttgatatcaggcacataatgctcgtcgccgacatgatgacgc tcgacggtgttataaggccgataggaaggcatggaatagtcggtgagaagtcgagcgttttagcaagggcggccttcgag atcacaacgcagcacctgttcgaggccgccgagaggggagaagtcgatccgctcaacggagtcgttgagaacgtcctcat cggccagcccgtgcccgttggtacgggaatcgttaagctgacaatgaatctccccctgagaccgcaaagggag TAGGGA GGTGTAGTTGATGGTTGATTTCGCCTTTGAGCTTAGGAAGGTTCAAGATACCGGAAAGCTGGTCATGGGAGCGAAGAAGA GCATCCACTACGCCAAGGTCGGCGGGGCAAAGATGATTATCGTCGCGAAGAACGCGAGGCCGGACATCAAGGAGGACATC TACTACTACGCCAAGCTCAGTGGAATCCCGGTTTACGAGTTCGAGGGAACCAGCGTCGAGCTTGGAACGCTCCTCGGAAG GCCCCACACCGTTTCGGCTCTCGCGGTGATAGACCCCGGTGAGAGCAGGATACTCGCGCTTGCTGGGGGTAAGGAGTAAT GCCGCTCAAGCTGAACACGGACCAGATAAAGTACATAGCACTCTTCGAGAGCATGACAGGGGCAACTGTGCTCGACTGCC TGATAGATGCCAACAGGAACAGGCTCATCTTCGTCATCAAGAAGGGGGAAATGGGACTGGCACTCGGAAAGAAGGGAGCA AACGTCAAGCGCGT