

>tg1926 DNA-directed RNA polymerase subunit B (rpoB)

>tg1926 DNA-directed RNA polymerase subunit B (rpoB)

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1849248 - 1853613 (Additional range around tg1926 is :500nt.)

>Thermococcus gammatolerans EJ3 GCGCGGGTGTTAGTATTCTTTGCACGTTTAAAAAGTTTACGTGTTCCTGCCCCTCGGCCCACTGAACATCCCTGTTCCTT GAAAGCCGCAATAGGACAGGGAAGGCTTCTTAAACTTTTCGTAAGTCCTATAAACCTCCCCCCGCAGTCTAATCACGAAA AGCTTATATAGGTGAACCGGAAGGCGATGGGTGTGGCGGTCATTCTTGTAAAAAACTGTAAGGGGGCATTTCTCGGTGGC GGGGAAAAAAGAATTTAGTGTGTTTATGCACGAGCTGGTTCCCGAGCACAGGGTTATCAGCGAGGAGGAAAAGGAAGAGC TCCTCAGAAGGTATCGCATTAGACTCTCCCAGCTTCCGCAGATTAAGGCATCTGACCCAGCGGTCGTTGAGCTTGGCGCG AAGCCTGGGGATGTTATAGAGATCAAAAGAAAAAGCCCGACGGCCGGGGTTTACCTATACTACCGGCTGGTCGTGGAAGA CTGATTCTGAGGTGGGATC atgagcgcgagaggagttactgttgttgatgtcactcccgacgatctctggattgttatg gaatcctactggaaggaaaagggtctcgtcaggcagcacctcgattcttacaacgcattcattgagcacggcctccagga agttataaatgagttcggtggtgtcaaaccggacatccccaactttgaggtcaagttcggaaagatacgcctcggagagc ccatctttcaggaggcccaggggcagagaagacccctgtatccaatggacgcccgcataagaaacctcacctactccgcc ccgctgttccttgagctgatacccgttgtaaacggcatagagcaggaaccagttgaagtccgcatcggtgaacttcccct catgctgaagtccaaggcctgcaggctctacggcctcagcgacgaggaactcatagagctcggcgaggatccgaaggatc cgggaggatacttcataatcaacggttctgagagggttatcgtctctatcgaagatctggccccgaacaaaactctggtc gagaaggatgagaggcagaaaaaggtcgtcgccaaggtcttttcatacagacatgggtacagggccctgataacagttga gagcagaaaagatggtatactgtacgtttcaattccgaacgttcccaagccggttaagttcgtctacgtgatgagggccc tcggcctgctcagcgataaggagatcgttgaggcaataagcgaggatccgaggatccagcaggttctattcaacaacctt gaggatgcaagtgacataagaacccaggaagaggctctcgacttcataggaaggctttccctccccggtcagcccaaaga gtacagactcaggagggccgagcacataatagacaacaacctcctcccgcacatgggcgtcgagcccgagaacaggaagg ccaaggcttactacctcggcatgatggccctcaaggttcttgagctttcgctcggcctccgcggtgaggacgacaaggac cactacgccaacaagaggctcaagctcgctggagacttgctcaaggatctcttccgcgtcgccttcggccagctcgtcaa ggatatgcagtaccagatgaccaagacctaccagagaaagggcgagcgctacaccttcgagaacatccagcgctttgtga ggaactccgttaggccggacgttctgagcgagaggatcgagcacgccctcgcaactggttcttggcccggcggaagaacc ggtgtgagtcagctcctcgacaggaccaactacatatcgaccctctcccacctaagacgcgttacctccccgctcagcag ggagcagcctcactttgaggcgagagatctgcacggaacccactggggcaggatatgtccgacggagactccggaaggtc caaactgtggtctggttaagaacctcgccctgatgtcccagataaccactgggatcccggaggaggaggtcaaggagtac atcctcaaactcggcgtcgttccaattgaagagagaagaccttcacccggactttatcgtgtttacctcaacggtgttct catcggaaccatagaggacggaaaagcccttgttcagactataaggtcggatagaagggcggggaagataagcgacgtga tcaacgttgccctctacgaggagggggacgttagggagatctacatcaacagcgacgacggtagagttaggaggcccctc atcatagtggagaacggcaggccaaagctcacccgcgagcacgttgaggctataaagaacggcacccttacctggagcga cctgataaggatgggcgtcatcgagtacctcgatgcggaggaagaggagaacgcctacgtggcaacctggccctgggagg tcacggaggagcacacacaccttgagttaatgcctgccgcaatactcggtattcccgcttcgctcgttccctacccggag cacaacgcggccccgcgtaacacctacggcgcgggtatggccaagcagagcctcggtctcggctgggcaaacttcaggat tcgcgttgatacaagaggtcacctcatgcactacccgcaggttccgctcgtcaactcgcgcatcatgaaggccgttggtt tcgaggagaggcctgccggtcagaacttcgtcgtcgccgtactgagctatggcggttacaatatggaggatgccatcgta ataaacaaggcatcgatcgagcgcggtctcgcgagatcaacctttttcagaacgtacgaggcggaagagaagagatacct gggcggtcagatggatcgctttgaaaagccagatccgaccatcaagggctaccttggcgatcggtactaccgcaacctcg acgaggacggcataatcttcccggagtcaaaggttgaaggaaaggacgttctcgtgggcagaacgtcaccaccgaggttc cttgaggagcagagcggcctcgggggaatagccctccaggagaggagggagactagcgttgccgtcaggccgagcgagaa gggtatagttgacaaggtgataataaccgagaccggtgacggtacgaaactcgtaaaggtcaccgttagagacctgcgca tccctgagttgggtgacaagttcgcgagcaggcacgggcagaagggtgttatcggcctcatagttccacaggaggatatg ccctggaccgagaatggcatcgttcccgatctcatagtgaatcctcacggtatcccgagccgtatgaccgtcggacagct catagaggccataggcggaaaggtcgcctcacttaagggaaggagagttgacggtacggccttcatcggggagccggaag agaagctcaggaaggagctcgaggagctcggcttcaagcacacgggcagggaggtcatgtacgacggtataaccggcagg aggcttgaggcggacatattcatcggcgtcatctactaccagcgtctgcaccacatggttgccgacaagatgcacgcgcg ctcaagaggcccggttcaggttctcaccaagcagccgaccgagggaagggcgagagagggtggattgaggttcggtgaga tggagcgtgacgtcctcgttggacatggcgctgcgatgctcttgatcgagaggctcctggaggagagcgacaagacggag gtatgggtctgtgaaaactgcggtcacatagcccttgaggacaagcgccgtggcaaggtctactgccccgtctgcggtga ggaggagaggataagcaaggtcgagatgagctacgcgtttaaactgctcctcgacgagctgaaggcgatggtgattagac cttccctcaagttgaaggatagggtg TGAGAGCCATGCAGTCGATGAAAAAGGTCATCGGGAGTATCGAGTTCGGAATA CTCTCACCCCAGGAAATCAGAAAGATGAGCGCTGCCGAAATCACAGTTCCTGACACCTACGACGATGACGGTTACCCTAT TGAAGGAGGCCTCATGGACAAGAGGCTCGGTGTCATTGACCCCGGTCTCAGGTGTGAGACCTGTGGAGCCAGAGCCGGGG AGTGCCCGGGACACTTTGGCCACATAGAGCTCGCGAGACCCGTTGTCCACGTTGGTTTTGCCAAGACTATTCAGCGGGTC CTCGAAAGTACCTGCCGCGAGTGCGGGAGGATAAAGCTCACCGACGAGGAGATAGAGGAGTACATGAAGAAGTTCGAGGT GATCGGCGACCGCAAGAAGGACAAAGACCGGCTCATCAAGGAGATCCACAAGAAGGCCAAGGAGAGAATGGTCTGCCCGC ACTGTGGGGCACCGCAGTTCCCGATCAAGTTCGAGAGGCCGACGATA