

>tg1940 Translation factor, putative, Sua5/YciO/YrdC/YwlC family

>tg1940 Translation factor, putative, Sua5/YciO/YrdC/YwlC family

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1865015 - 1867043 (Additional range around tg1940 is :500nt.)

>Thermococcus gammatolerans EJ3 GCATCGCATCCACTTCACCGCTCACCTTTTTAAGGGGATCGTCAAGAGCGAGCTTTGGTGGAGAAGATGCCGGTAATAGG GATCAATCTGACAAAGATAGAGTTCGAAAAGAAGGGAGTACCACCGATTGGGGGCAGGATTGAGGTCAACCTGACGCCCA AGGTCAGGGATATGAGGCTTGGCGAGATTAGAAGTCCCACGGGGAGGATGAACGGGGTTGAAATACTCTTCAAGTACGAG ATAACCTACAGGCCCGAGATAGCCGAGGGGCTCATAGAGGGGGCCGTTATGTACCTGCCGCAGAGGAGGGAGGACGTGGA TAGAATCCTCGACACGTGGGAGGTTGAGAGGAAGGTTCCCCCCGAGGTGTTTGCGGAGGTTATAAACTTCCTCACCGCCG AGATAAGCCCGCTCCTCTTCGTGATCGCCAAGGAGATGCGCCTCCCTTACCATATTCCCCTGCCGAGAGTTGAGATAAAG CCGCAGGGGTGAGGCTTTG gtgaccattgtaatccccatgagggccggcccggatgagcgattgaaggtcgcagcaagg ctcatagtagagggaaagctcgttgcattccccaccgagactgtttacggtcttggcgccgatgccctgaatgagagggc ggtcaggaggatcttcgaggccaagggcagacccgctgataatcccctcataatccacatagccgagagtgaatggctct ttgagcttgcgagggaagttcctgaggttgccctcaggcttgccgaacgtttttggcccggtccgcttaccctagttctg cccaagggggagaaagttccctcggtaacgacgggcggcttggacactgtggcggtgaggatgccggcccatccgatagc gcttgaactcataaggctcagtggaaggccgatagcggctccttcagccaacataagcgggaaacccagcccaacggaag cggatcacgtcgtggacgatttctacggaaggattgagtgtataatcgacgggggtcccacgccgataggtgttgagtca acggttcttgatctcacgggggaggttccagttcttctgaggccgggcggccttcccctcgaggatattgaaagggtcat aggcagagttgatgtgcatcctgcggtaaaggggattgaggtgaaccttgcgaaggccccgggtatgaaatataagcact actcccccaacgcccaggttatacttgttgaggggccaagggaagctgttagaagaaagatggaggagattgtcgaggag ttcaggagtaggggccttaaggtcggtgttatggcaacggagaagtacgatgcggatgccttcttccatcttggggaaag tatggaagaggtcgccagaaacgttttccgcgcgctcagagagctggacaaagcgggggttgacgtgatactcgcggaag ggatagaggagaggggactcggtctggcggtgatgaaccgtctcaggaaggccgccggctacaaggtgatccgggcggat aaacttaaa TAGAAAAATCTCCAAGGAATTGCATAGGTGCGACCCTCAAATCACGGGGTGAGAACGTTGGCTCTGATTC CTGATATGGCTTCACCCGAAGAACTCGAACACCTGGGCTTTGAACACCTCCGAAAAGGTGAGCTCAAGGAGGGCCTTAAG CTGATCCTCCGTGCGGCAAAGAAGTATGAGGACGAGAAAAAGCTTGAGGACGCCGCGAGGCTGTACTATTACTTCGGCTA CTTCTTTCTCGACAGGCTGAAGAAGCCCGACAAGGCCAGGCCTCCCCTCCTAAAGAGCGCGGCCCTTTACATAGACCTCA TAGAGAGGGAACTCAGCCGCTTCGACATCGACACGGAACGGCTTAATGAGTACTGTACCAAAACGCTCTCTGTTTTCGCG ACCGTTGGGGACGAGAAGAACCTGAGAAAATACGCCAAGTACTTCGCCGAGATATACGAGGACATGGCGAGGAGCTACAT GGAGAACGGCGAGGTAGAGCTTGCTGTCAA