

>tg1950 Signal recognition particle, subunit SRP54 (srp54)

>tg1950 Signal recognition particle, subunit SRP54 (srp54)

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1872713 - 1875056 (Additional range around tg1950 is :500nt.)

>Thermococcus gammatolerans EJ3 CCTCAGAACTTCCTCACCAATCCCCGTTTGTGTCTTTTTTTGCATAAAACCCACCAATACTATAAAAGAGTGTTCTGATA TTTAATCCTTGCGAATTCAAATGGGCTTATTGGAAAGGGCTCAAACAACGAAAGTTTAACTCATTTCGTCGTACACGACG CTGACGGTTTCGCCATCTTCGAGAACCACGAAGCTGACCTTGGCTTTTTTGCCGGTTTTCTGGTCCACGACAAGGAAGTC CGGGTCCTTGAGGTACTCGCTTCCGGGCATTTTCCAGACGTCGTCGTAGTACTCCTTTAGCTCTCTTAGGAAGAGGGCAG GGTTCCTTCTTATCACGGTTGCCATAGCGCATCACCGGTATTATATACAACCTCAAAGTATAAAAAGATTTCGGAAAGAC GATCGTTAAACATGATTTCGACAATCGACGTTATAAAGTCGCCGGGATGGGCACAAGGGTTATTAACTCCCGGGTGTCTT TGATTCAGGAGGGGTGAAG atggcacttgaaaagctcggcaaggctctaaacagtgccctgagaaagctggcgagatcg agtacagttgatgaggcgctcatcagagaggtagttagagacatccagagggccctcattcagtccgacgttaacgtaag gcttgttctgcaactgacgaaaaggatacaggaaagggccctcaacgagaaacccccggcgggtgttagtccaagggagc acgtcattaagatagtttatgaagagctgacgaagctcctgggaaaggaagcggttccccttgagatacgggagaagcca acgatattgctcaccgttgggattcagggatctggtaagacgacgacgatagccaaactcgccaggcaccttcagaagag gggctacaaggtgggcctcgtgtgcactgacacctggcgtcccggtgcgtactaccagctcaagcagcttgttgagccct acaacatagaggtcttcggcgatcccggcgaaaaagacgccataaaacttgcaagggagggcgttgagtacttcaaggat aagggagtggacgttataatcgtcgatacagcggggaggcacaaggaggagtcaggccttatagaggagatgaagcagat aagcgaggccataaaacctcacgaggtcatcctcgtcattgatggaactataggccagcaggcctatcatcaggccctcg cctttaaggaggccacaccgataggctcgataatcgtcacgaagcttgatggttctgccaaaggcggtggggcgctctcg gctgtggcggcgactggggcaccaataaagttcataggtgttggtgagaaaatagacgatctcgagcccttcgatccgaa gaggttcgtttcaaggttgctgggtctgggtgacattcagggtctgctcgagaagatcgaagagctgcagaaggagcagg agttcaaggaggaggacgttgagaagttcttgaggggtaagttcaacctcaaggacatgtacgcccagcttgaggcaatg cagaaaatgggcccgctcaagcagatactccaaatgatacccggcctcggctactcccttccggacgaggccgtaagagt aggcgaagaaaagctcaggcgataccgcattataatggactccatgacggaagaggagctggagaacccggacataataa actactccaggataaagaggatagccaggggttctggaacatcaacgcgcgaggtcagggagcttttggcccagtacaac cagatgcgaaaaatgtttaagaacttagacaaaagaaaattggcaaagatggccaagaagttcaactttggagggctggg gata TGAAGAAGATTGAGGCAATAATTCTCGTGGTTGCCAGGCCCGGTACTGAGGAAAAGGTCTACGAGAAGCTGAAGA AGCACCCCAACGTCAAGGAGATATACAGGGTCTACGGTGAGTACGACCTGATCCTAAGGGTTGAGGTCGACACGATAGAG GATCTTGACAGATTTCACGATGAAGTCCTGAGGAGGATCAGGGAGATAGAGCTAACTGAGACGCTTATAGCCAGCACCTA CGGCCTAAAGGAGGGCTGAGGTGAGAGAGTGGCCACCGAACCTAAGAGAACGCTGGTGGCCATAGTCGATCTTTTAACTT TGAAGGTCGAGGTGGTCACACCCGTAAAGTTCAAATGCGTTGAAGACTGCGGACGCTGCTGCTATGAGCTTGAAATCCCG CTGCGCGACGAGGACATTGAGGCGATCGAGGAGCTCGGATACAGTGCATGGGAATTCGTGGACTATGAGAAGATGTTCTA TCGTGGCGACAGGTTCCTCGGTTAT