

>tg1952 hypothetical protein TGAM_1952

>tg1952 hypothetical protein TGAM_1952

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1874511 - 1876827 (Additional range around tg1952 is :500nt.)

>Thermococcus gammatolerans EJ3 TTCTCAGGGCACTGTTTAGAGCCTTGCCGAGCTTTTCAAGTGCCATCTTCACCCCTCCTGAATCAAAGACACCCGGGAGT TAATAACCCTTGTGCCCATCCCGGCGACTTTATAACGTCGATTGTCGAAATCATGTTTAACGATCGTCTTTCCGAAATCT TTTTATACTTTGAGGTTGTATATAATACCGGTGATGCGCTATGGCAACCGTGATAAGAAGGAACCCTGCCCTCTTCCTAA GAGAGCTAAAGGAGTACTACGACGACGTCTGGAAAATGCCCGGAAGCGAGTACCTCAAGGACCCGGACTTCCTTGTCGTG GACCAGAAAACCGGCAAAAAAGCCAAGGTCAGCTTCGTGGTTCTCGAAGATGGCGAAACCGTCAGCGTCGTGTACGACGA AATGAGTTAAACTTTCGTTGTTTGAGCCCTTTCCAATAAGCCCATTTGAATTCGCAAGGATTAAATATCAGAACACTCTT TTATAGTATTGGTGGGTTTT atgcaaaaaaagacacaaacggggattggtgaggaagttctgaggatagccgaaacgat ccccgatccatacgttaggacaattacactcgccagactcggttatctcctgagtaaaagcgaaccccagacgtccgtga aggcgtttaagcttgccgtttcttccctcgactacatcgaggatccagtgctcatactcagggcgatggtctctacctca agataccttcgaatggcgggggtaaaggaactatcggagggcatgctgcacagagcctacgaaggggccctcctgctcag gggcagggtcaaggattccctgcttgtggagataatacgggagtccctacgagcgggaaagaaaagggacgccatactct acgccactgacattgaggatgaaaagctgaggaacagattgctcctcgagattgtgaagaacctcgttcaagaaggggat ctccagatagctagaaaggttctaaacgtcttcaccggtgaacccgaaaggtctcaggctatcgttgagataataagggg ccacctgaccagggaagaattcgcgagcgtgctctcactgctcccgacaatagagaacgagtactggcttgaaacggctc tcgaagaaactgcaaagagcctgagaggttctggagtgccaaaggcaacatacgaaaaatttgtggaggccgccaaagag ctctcggagagactggggaaggacctcttgagagcttttctgacgggtctcgtggagggaggcgatgtattgggggctgc ggagatactgaactccgtaacacgcaacagggagagcatagcgtcttatctctcgagattacttatcggcagaccgaaag atctggagtcttttgtgaaatccctacgactaagccctgaggaattcgatggggttgccaaggccaccctcgatgctctg ctcgagaaaaacccctctccagagtacaggggtgtcgtggagttcctagggagaaacaccgagaatgagagggttctggt taaggtcgcgacgtacttggcaaagatagggaacttcgagactgcagaagaattcgggaggatgatagacgatccttacc tgagatctctcgcctttggggcaatagctcttgaaaagctcaggagagaagacattgacggggcaatagacgccgttaaa aacgttcccgacgccgaatgggggtcctggctgatgggtgagatactcgttaaaatcgtggagggatcccttggagaata cccagagcgagagctggagaggaaagccgagcttcaccggagaagcatagaaggatcc TAGGAAGGGTCTAAAGTTTTA AACCCCCACGCCGTTCTATTTTCTACAGCTATTCAGGGGGAGTGAGATATGGTCAGGATAGCCATCATTGGAGGCTCCGG TGTCTACGACCCGAAACTGCTTGAGAACGTTAGGGAAGAAATCGTTGAGACACCCTACGGAACGGTCCGGGTTAAGATAG GAACCTACAGAGGAGAGGAGATAGCCTTCCTGCCAAGACACGGAGAAAAACACAGCGTTCCACCTCACAAGATAAACTAC CACGCCAACATCTGGGCGCTTCACGAGCTCGGCGTCGAGAGGATTTTGGCAACTTCAGCCGTTGGCTCTCTCAACCTCGA CATGAAGCCCGGCGACTTCGTCGTCCTCGACCAGCTCATGGACTTCACGAAGACGAGGCATTACACTTTTTATGACGGCG AGGACAGCCCTCACGACAGGAAGTTCGTCGCCCACGTGGACTTCACCGACCCCTACTGCCCGGAGCTCAGGAAGGCCC