

>tg1972 Centromere binding protein CBF5/pseudouridine synthase truB-like protein (truB)

>tg1972 Centromere binding protein CBF5/pseudouridine synthase truB-like protein (truB)

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1887558 - 1889559 (Additional range around tg1972 is :500nt.)

>Thermococcus gammatolerans EJ3 AACATCGAGCGCGGTGCCTCCGACGAGGAGATAAAGAAGGCCCTCGAGGAAGCAGGCATAAGCCTTGAGTGAGGGCTTTC CCTCACTCTTCTTCCAATAAGCTTCTTACCGTCCCGGTCCCTGTTCGTTTCGTCATTCTGTGGGTAGATACCTTCCCAAC TGGTCGGTTTTCACGTGCCGCTTCAGGTATTAGGTGGATTTATTAAGTCTAGACTCGAACTCTATGGGGGTGAATGAGAT GCAACTCCACGCCGTCATCTGGGAGGAAGAGGGCGTTTACGTCATTCGGGAGGTCTTCACGGGGGTTACCACTCAGGGGA GAGACAATAGAGGAGGCAATTGAGAACCTCAAAGAGGCCGTTGAGCTGTACCTTGAGGAGTTTCCAGAGCTGAGCTTCAC AAAGAGTTAAAAGCCGGTACGTTGATGGGAGTCCTGAGACTTGCTCAAATAAGCAAGGAGGACTTTATCAAAGCGCTGGA AGACCCGTAGGTGATGCTC atggcgagggatgaagtgaggagaatccttcccgctgacataaagagagaggttctgatt aaggacgagaaggccgagacgaacccgaagtggggctttccgcccgagaggaggccgatggagatgcacatgcagttcgg cataattaacctcgacaaaccacccgggccaactagccatgaggttgtcgcgtggattaagaagctcttcaacctgagca aggccggtcacggcggaaccctcgatcccaaggtcagcggcgttctaccggttgcccttgagagggccacgagggtggtt caggcacttttgccggcgggaaaggagtacgtagctttaatgcaccttcacggcgacattcccgaggacaaaatcctcgc cgttatgaaggagttccagggcgagataatccagaggccgccgctgaggagcgctgtgaaaaggcgcttgaggacgagga aggtctattacatagaggtgctcgagatagagggcagggacgtgctctttcgcgttggtgtcgaggcgggaacgtacata cgttcgcttatccaccacataggcctggctttgggcgttggagcgcacatggcagagcttcgtcgtaccagaagcggtcc cttcaaggaggacgagacgctggtgacgcttcacgatttggttgactactatcacttctggaaggaggacggcatcgagg agtacttcaggaaggcgatacagccgatggaaaaggcggttgaacatctgcccaaggtgtggataagggactctgccgtt gcggcggtgacgcacggcgctgacctggccgttcccggaatagtcaagctccacaagggtataaagaagggtgacctcgt tgcgataatgaccctcaaggacgagctggtggcacttggaaaggccatgatgacgagcggtgagatgctccagcggagca agggcatagcggttgacgttgacaaggtcttcatgccgagggactggtatccgagaatgtgg TGAGAGACTTGTCCCGG TTTCTCCACTTTCTCGATGCCTTTTCTTCTTCGGTTGAGACTCGAGGGGTACTGCTTTTCATGAGGTTTGTCCTCCTCTG GTTCTGGCTTGATGTTCTGCTCTTTCTGCTCCTCGGCCTTTTTGAGTACTCCATCAGAAACATCTTCAGTTCTGGGATAC TCCTCCTCGTATGGCTCGTGGCGTTAACTTTACCCAGGGTTTTTAGAAAATTGGAGGGGTTTGGGAGCCATCCGGGTTTC ACGTACCTTCTTGCCGTTCTTTTGATGGCGCTGTTTGAAGAAACGCTGGTGACCCTGAACGGGGGTGGGCTTGGGGGCAG GGCGACGGGCTTAGCACACGATCTGACGATAGCCGTTCCGGTCTTCGTGGGGGTTGGAACGGGGTTTTATCTGGCTCATC GAATGGCACCGATGTCGCGCGGTGCGTTCTTCCTCTTCGGAGCGCTCTTTGGATTCTTCATTGAGATAGTTCTGAACGGT GCT