

>tg2020 RNA 3′-terminal phosphate cyclase (rtcA)

>tg2020 RNA 3′-terminal phosphate cyclase (rtcA)

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1919535 - 1921566 (Additional range around tg2020 is :500nt.)

>Thermococcus gammatolerans EJ3 CTCTGTTCTCGTGGTAAACCTGAGGGCAGTTAATCTGAGGCCCCTCATTCCACCCGGTGCAGTTTTGCTGACGGAACCGG AGCCTGATGAAGTCTTGAGGCTCATGATGGAGGGCAAACAGGTAATTGTAGAAACTGTGTGGCCCTCCAAATACATGGGA CTTCCCTTTGGGGTGCGGGTAAAGATACCCCCAATGTCAAAAGAGGAATTCGCGGAAGAGCTCAAGCGAAGAACCGGAGT GTCTGTGGAGAGGGGCCTTCTGGAGGATTACCCCGAATGGCTCTTCAATTACCGGAACCTTGAGTTCATACTTCAAATCT TTGAAAAACTCGTGGAGAAAGGAGTTGAGAAGGAAGAGGCCCTTGAAATAGCCGTGATGGTGAACCTTGGCTTCATACCT TCAGAATTCGAGGGCCTGAGCTTGAAGTCTAAGAGATGAGTTTCATTTTGACGGCATTAACGTTTTTAGGCTATTGTGAA ACTGCATTAGGGTGGGAGA atggagtgggttgagatagacggctcgtacggcgagggagggggacagatactcagaacg gccgtagccctgtctgtaatcacagggaagccggtgaggattcacaggataagggcaaaccgcccgaaccccgggctaag gccccagcacctgcacgggattttagcactcaaagagctgagcaacgcgagggttaagggggcaaaagttggctctacgg tcctcgagttcgttcccggaagggccgagccgaagcacgtcaaagtccctataaagacggcaggtagtataacgctcgtc ctccaggcgctgcttcctgcgatggctttcatcggcggaagtttcgagataacaggcggaaccgacgtgccctggagccc gccggttgactacctgaggaacgttacgctcttcgcgctcgaaaagatgggcctgagggcagagattgagctcaagagga gggggcactaccctaagggtggtggccttgtcacgggaagtgttgaaccctgggagagtaaaaagcccctcgttgccctt gagtggaataaagtagatagcttcgccgggataagccacgcgacaaatttaccggcccacgtcgcggagaggcaggcgaa atcggcggaggagagattgagagagtttttcaatgcccctgttgagatagagactgaagtatcacgttctcttgggcccg gaagcggaatagtggtttgggccgagacggactcgcttaggttagctggagacgccctcggaaagcgcggaaagccggca gaggtagtcggcagggaagccgctgaagagctgattgagcaactgacgccgaggaaggccgttgacaggttcctcggcga ccagctgataccgttcctggccttcgcgggcggagagataggcgttgcagaaatcacgaaccacctcgtcaccaatgtct gggtcgtggagcggtttttgggtagaactttcgaagtcgagggagaaatcggagagcccggggttgtgagggtggtaagg aaggcggaggtc TGACGAAGGGGTTAAATATGCCACAGTTCTTAGTAATGATGGTGAGAGAATGGAAGGTGTTGAGTAT ATATACGATGAGCATGGACGAATTAAGGGTGTGATAATACCGCCAGAACTTTGGGAGAAAGTTAAGGGCGAGCTCTTTGA TCCGTCAAGATATAGGGGTATTTATAAGGGCAAGAAGGACCTTGAGAAGAGCCTCAGGGAGCTGAGGGAGGAATGGGAGA GAGATTTTTGATTGACACCAACATTCTCATCTACTACCTTGCGGACGCCATTCCTAAAGAGGAACTTCCAACGATTGAGG AAATCCTTAGAGGAAGCTTCAACGTCTCCATAATCACAAAAATAGAGTTCCTTGGCTGGAAAGGACACACTCAAGAGGGT TTTGAAAAGTCAAAGGAGTTCATAAGCTTCGCAAACGTCATACCACTCACTGATGAGATAGGAGACGTTGCCATTGAACT CAGGCGAAGGGTTAGTATAAAGCTCCCGGATGC