

>tg2064 ATPase of the AAA superfamily, putative

>tg2064 ATPase of the AAA superfamily, putative

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1962288 - 1964604 (Additional range around tg2064 is :500nt.)

>Thermococcus gammatolerans EJ3 AGAGCAACCCAGATTTGGCCGCTCATTTCACGGTCTTCCTCGACCTCAGCGAGAAGGAGGTTGAATTCCTCGCTGGAGAC TCCGAAAAGGCAAAAACAATCTGGGGCAAAGCCATGAACATCGAGAAGAAGCTTAAGGAGCGGGGCAGGTTGGAGACGAG CGTTCGCGAGGGCCTCAGGAAAGCGAAGGAGAAGGAAGAAGAGGAGATGGAGTCGGAAGGGGCCGAAGAAACCGGGGAGA CTGAGGAAGTCCCTCAAGGAGAACCTGAGGAAGGGGAGGAACTCAGCGAGGAAGAGCTTGAGGAGGCCGAGAGGGAGATA GAGCCCGTGGGGAAGAAGGAGAAGAAGCCCGAAAAGAAGAAGGGCAAGCAGGCGACGCTGTTTGATTTCTTGAAGAAGTG AGTTTCGCCTTTTGTATTCTTTGCAATACAAATCTTTGCAATTTTTATATTCCGAAAGATATAAAATCTCAAGTATTCTA TACTCCTTTGGTGGGAAGAA gtgctcacaagggaggagatagttgaggttttagcgccctacaacctctggggcggtag aaaatggaacgccataccgagggacgaatacctctcagaaattgagaggaaactctccgcaggtgttgttgcgcttgtgg ggacccgacgttctgggaaaactactctcgcggggcttttcctgaagaaagccatagatgatggccttcctccagagggg acgctctacgtgaacctcgaagacccgcgcttttccccctacctctcgcccgagttcctcgaggaggtgttttctgccta caggacgtacgtttacgacggcgatggccccatcgtggttctcgacgaggttcagaacgttccgggctgggagaagtggg tcagaaaggttctcgacctcagcgaggcgagggtcatagttacgggctctacctcctcactccttcgctccgagctctca acgctcctgacaggcagggttcttccggtggaggtttacccgcttagttttagggagttcttgatattcaggggattttc cgctgacttcaaacgcttactgggtaaacggagaaaggtcgaggccctcatgagagagtacctcgagttcggcggctttc ctcaggttgttctcacggaggatgatgccctcaagctcgaactcctgagggagctttttgagggcatagtcctgagggac attgtctataggcacggcttccgtgatgcgagggctgttaaaatagtcgccgagctggcactgagcaggttttcctcact ggtgagcgtttcaaggctgaggaacgagctggctggaatactgagtaggaaagtctctccgaacttcgttgatggtgttc ttgacgcgatggatgaagcttatctgagcttccgcgttccaatcctctcgccgaaagttaaggacgcaatgcactacccg aagaagatgtacgcgattgacactggaatagcgaacatcgtggggatacactttacaggaaacattggaaggctcgccga aaacgccgtcgcgaggcatctccgccagcgcttccgtgaggtctactattaccgcggaaagggagaggttgatttcatcg ttaaggagggcctcagggtaacgcgtgccgttcaagtgacctgggacatcgacgagagctgggagcgggaagttgaaggc ctcttggaggctatggacgtcttcggcctgaaggagggcgtaatagttactggctggcgttcctgcgaggagaggtttgg ggagaaaactgtgaagtgcgtcccgctgtggaggtttttgatatggttatggaatttg TAAACTTTCATATAGTCTTTC CATTTTCTCTTTAAGTTCCGGGAGCTTGTTTTGGATAAGGTCCCAGATTAGCTCGACGTCAATTCCGAAGTACTGGTGGA TTAGTATGTTTCTCAGTCCAATTATCTTGCGCCACTCTACCTCTGGGTGTTTCTCCCGGATTTCAGGAGGGATTGCCCTG CACGCTTCTCCGATTATCTCGAGGTTTCTCACGACGGCATCTACGACCATCTTGTTTATCCTGAACTCCTCAAGCGTCAT CCCATCAGTGTACTCCTCGATTTTCTCTATGGCTTCTAAAATGTCCTCAATGTAGATTCTATAGTCCCTCAACGCTCACC GCCTCGCGCCATACGTACTTCCGGACCCTCGGCTTCAGCGCCTCGACCGTTATCAGGTCAACTTCCACTCCGAGCAGGTC TTCGAGAAGGAACTTCAGCTCCATGTAGTTGTCGAAGGTCTTCTTGCCCTCTTCAAACTCCACGAGGACGTCGAGGTC