

>tg2070 RNA-binding protein FAU-1, ribonuclease E-like protein (FAU)

>tg2070 RNA-binding protein FAU-1, ribonuclease E-like protein (FAU)

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1967082 - 1969494 (Additional range around tg2070 is :500nt.)

>Thermococcus gammatolerans EJ3 AGTCCAGAAAAGCGAACACCAGATGAAGTTCCGCCTTGAGGAACTCCTCGGCATTCTCTCAAAGCCAGACCACTATTCCG AAAGAACCAGACTTAAGGCCTCACTCGACAGGCTCGTACACTTCCACCGCATATACGACTACACCATGAGGAAGGCACTT CAGGCAATTGGAAAGGAGATCGAGAGCATAGAGTTTCTCGAGCGGGTCGGGGGAAGCGAAAATCAGAAAAAGGTCCCCAC TGGTATAGTTGAGAGACTGAAAAAAATTGACGAAATAGAGAAAGCCCTCGAGACGTCCCTGGTGTTCATGAGGAGACTCT ACCTCCATCCCGGGGACGTGTACCGGGTCGAGGAGGCTCTAATCAGATGGCACAGGATGGGACTGCTGTGGGTTGAGGCG AGAAACGTTGAAAAGCTCAGCGGCGTCAGGAACGCCGGCGAGATCCTTGAGGGGCTCACGCTCATTGGAGTAGTGGAAAG GAAGGAACGGGGGGGTGAAA gtgtctacagacacaggagtttcagttcgggttaggggaatatacagcacggccctgac gaaactcttcctcgacagggggtttaggatcagccagcccagccagaagatagccgaaaggctcgggatcgagaagacct acgacgagttcgacgtggacatctacgacaagagggatcatcacggggtgattctcgtcggtaccgaggttgagaaagtt aaggaagtttttgaggaggagtttatagacgtcctcttccggaagcttccgtatcagctctacggcatttacaaagggct tgttataaagagggacgaacgctacgtctacgtcgatatagggaacgcgataggcacgattccggtggaggagggaaaaa accttcacgagggcgacgaggtccttgtccaggtcaagaagcacaacctccttcctcacctgagcacgatgctgacgatc cccggtgattacgctgtgctaataccgaaacccgtcggcgttcagaggcacgtcaagatctcccggaagatacgggacag ctctgaaagagaaaggctcagaatactcggcctgagcatagacatgggtgagtggggaatcctctggaggactgccgccg cttacaaggactggaacaccctcagggacgagataatacgcctctccaagatcgctgacaggctcaaggaagccgagaaa aaatccgccccggagcagatcgttgaaggaaggaacatatacgaggtcgagttcggaggaggggcgaagaaaaagcttga cgaaataagaaacagggttgttccaacggtcgagggacaccacatgctcaaggcctacgacgtggagttcagctttgccg ttgagatagccgaagggatcctcgcgaaggtgcccggccagagaattaaggtcaatcagggcttctgggaggctttgctc gactcaaaggggccaaagaaggggtggctcttcttcctcgaacacaacaagccggacggccagaggtacaaactcggacc gggagagatagttgaggtaacgttcaacccgctcaggataaccctgaggagaaacctcaaacccggcaagttctacgacg gcctcgacctgcccatagagttcggcgactacgccataactgagatcgaggccggcaagtggtggttcgttcaccgctac tacgacaggaacggcaacctgaagggggagtactacaacatcaacacaccggtggagatctacccagacagggcccgcta catagacctcgagatcgacatcgtgaagtggccggacggggagaaggagataatagataaagacaagctcagggagcact acgaggacgggattatcagcgagaagctatacaaggccgtactgaggatcacgcaggaagtctacgagaggatt TAGGG AAGCAAGTCTATCCCGAGCCTCTCTGCATCCCTTCTTAACTTTTTGTCATACGTGACGAGCCTACCGAACTCTTGGGCGG TTGCGAGTATTACCATGTCGTTAAAGCGTTTAGGATTTTTGGCCAGTTCGAGCGCGCGTTTTGTGTACTTCCCGCTGTCG CCCACTACCTTCGTCCTTGGGCTCTCCAGGATTGAGGATATCACGGCGTTTATTTCCTCCACTCTATAGCCTTCCCCCCT GAAAAACCAGTAGAGCTCATACAGAACTATGCTCGGCACAACCCACCGTTCCAAGGATGCGAGCAGTTTCCTTGCCTCTT CGTTAAACTCAGAATCCCTCAGGACGGCATAGACGAAGACGTTGGTGTCTATGACAGTCATTCTTCCTCACCAAGTCCTT TGAGAATTTTCTTCTCGATTTCTTTAACGGTCAGCCCCTTTCCTCCCGGGAGCATTGGGAGCTCAAGATCGCTCTTTTTG AGGACTATTTTTCC