

>tg2076 hypothetical protein TGAM_2076

>tg2076 hypothetical protein TGAM_2076

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1970716 - 1972891 (Additional range around tg2076 is :500nt.)

>Thermococcus gammatolerans EJ3 GGAGTGAGGGGAAGGAGTAAGTGTCACCTGTGTGGAAGAGCCGTTTATCCCCCTCGATGAGATAGCCGAGCGGGTACTGG CTCGAGGGATGCTCCATAAAGAAGGCAGTGACCTTTACACCCTCACCAAGCTCTATGGTTTCACCCTCAGAGATCTCCCG AACCCTCGTGACCCCGTCGGCGATTGCCATCAGGTAAACGGGCTTGGGGCCGATCACAGTTGCACCCCGGAGGCGGGAGA GAAGCTCGACCTTCCCGTAGTGGTCCGTGTGCTCGTGCGTTATCAGAATGTAGTCCACATCCCCTATCAGATCATCGTCC ACGTCCGGGTACGGGTCTATCAGTATCTTAACTCCCCTCGTCTCGATCCAAAAGCAGGAGTGACCGTACCATATGATTCT CATCACGTCTCACCGGTAGGTGAGTTGGAGACTGAGAACTTAAACGTTTCCCAAGAAAAGCGTTTAAGGTTTCCCCTGGA AATAAGGTCTGGAGGTTAGA atggagaagaaagacctcaagaaaaccctcacctcactggtgctcgtcttgataatcct cgtgagcctagccgcggccagcacgaacacgagcaacgatgtcctctcccaggtgaactccatcctgaagaaggtcgaag agatcaggggattgactttcaaagaacatccggagatagtggttctcacacgggaagaggccagagaaagattcaggcct ggaaggccagacataaagcgaatgaggcttgaggaagacgtctataagatgagcctcctcctgccccccaactaccccta cgtccacgagaaggtcgagcagagcgtgggatggatagccgtcacgatcggtaacacgatctacatcatagcggagaact ttctctccgatccggacacggccaggagagtcattgctcatgagtccgttcacgttctccagaagcagtggttcaatgcc ccctacggcgggccgaccctcgacaccacaaaggcgatacaggcggcgatagagggcgatgccgacctcgtcgcggacat ctactgcaacgaaacggggatcccgatccacaagataacggacctctacaccagggatcctgtaacggcactgggcatct tcccttacgtctttggtgacaggttcgtcgcatacctctatcgcacagggggatggaggctcgttaacgagatgtacagc catctgccgaatacgaccaaagtcgtgatgtttcccagcttctacctccagaactggacgcccatcgacgtcagggccga tgtagaaaggctggtaccaaagaacgcaacaataaggtactccgacaggatgggggcctactacgtgttcctgatctact ggggacacaacgccaccagggagaaaggaatggagatggccaagggctggtacggagactggctgatcatgggggacgtc aacggcaccaacggaaccgagcggttcctggtgtgggaggttctcttcgacacccccgagcacgcgacaacctttgggaa cttccttgagagaattgcaaaaaacgacgactacgccacatttacagttaaaaccagcgaacagagggttacactcctgg ccaaaaagaccctctcggaggggaaaaccgatgaaagtgaaggggaagttgaagtgctcaatctgtggaaagacata TG ACAAACCGCTTCAAAGATGTGGATGCGGTGAGCCCGTCGAGTTCGAGCTCTTCGAGGGAGAACCCTACATAGGGAAGAGC GTCTGGGAGCGGTTCTGGGACTTCTGGCCGCTCGAGCCCGCGCTTGACTTTTCCCTTGGCGAGGGCGACACTCCGCTGGT TAAGTCAAGGCTCGGCGACGAGTTTGGAATAAAGCTCTACCTCAAGAACGAGACTGTGAACCCGACGTGGAGCTTCAAGG ACAGGGGAACTTTTCTGGCGATGAGCTATGCCCTCAAAGCCGGCTACAAAACCGTTGGGACGGTCTCGACTGGAAACATG GCGGCGAGCGTCTCTGCCTACGCCACCCGCTTCGGACTTAAAGCTAAAATTCTCGTCTCCGAGAGCGCGGGCGACGAGAA ATTAAAGGCCGTCTCGGTCTACGGCGGAGAAGTGATAAGGGTTCACGGCGACTACGGGAGGCTCTACTTCGAGAGCCTCA AGCTGGGAGAAAGGCTC