

>tg2082 hypothetical protein TGAM_2082

>tg2082 hypothetical protein TGAM_2082

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1975931 - 1978274 (Additional range around tg2082 is :500nt.)

>Thermococcus gammatolerans EJ3 ATTGGCGAGGCGCTCTATTTCCTCTACCTCCTCGGGCGTTGGCTTCCGATTGAACTTGACGGTCAGCCTTCCGAAGCTGG AAAAGAAATTCGGAAAGTGCAGGTTTGCAAAGCCAAAAGAGGTCAAAGAACTTACAGGCTACGAGGTCAGTGGCGTTTCT CCCGTCGGCGTGCCGCTCAGGACAATAATTGACCCAAGGGTTCTGGAGAACGAGCACGTCATCGGCGGGGGAGGGGCCGT TAACAAACTCATCAGGATAAGGCCCGAGAGAATCGTCGAGTACCAGCGGGCGGAGATAATGGACGTTAGAGAATAATCGG GCCAGTTATCAACCCCACAGGTAAATTCAAACGGGGAATATTCAGCCGTGTTTGGATGTTTTTCAGTTCAATAATAGCTT TATCGAATAAATCCCGCTTAGAGCTTGTATTATTAAACGAAAACCGTTATAAGTGTAAAGCTCGATACGTCAGCGGACAA AGTTTTAGGGGTGAACAAAA atggccgagaagaaaaagaagagggtcctgattctcggagcggccggaagggacttcca caacttcaacgtgttcttcagggacaaccctgaatacgaggtcgttgccttcaccgccactcagattccggacatcgagg gcaggctttacccgcccgagctcgccggcgagctctacccgaacggaatcccgatatggagcgaggatgacatggagaag ataatcaaggagcacgacattgatatagtcgtcttcgcctactccgacgtctcccacgagcacgtcatgcacctcgccag cagggcccacagcgctggtgccgacttctggctccttggacccaagagcaccatgctcaagtccagcaagcctgtcgttg cggtcaccgccgtcagaaccggctgtggaaagagccagacctcaagaaaggtcgcccagctcctccaggagatggggtac aaggtcgttgccataaggcacccgatgccctacggtgatttgaggaagcaggtcgtccagcgcttcgccacattcgagga cctcgacaagtacgagtgcaccatcgaggagagggaagagtacgagccctacatcgagcgcggtatggtggtttacgcgg gcgttgactacgagaagattctccgcgaggccgagaaggaagccgacataatcctctgggacggaggaaacaacgacttc ccgttctacgagcccgacctctggatagttgtcaccgacccgcacaggcccggccacgagctcaagtaccaccccggtga gaccaactttagagccgctgacgtcataatcatcaacaagatcgacaccgctaacagagacgacatccagaaggtccgcg agagcatcgagaaggtcaacccgaacgccaccgtcatcgaggccgcttcacctatattcgtggacaaccccgagctcatc aagggcaagcgcgttctcgtcgtcgaggacggtccgaccctcacccacggcggcatgaagtacggagccgggtacgttgc agcgaagaagtttggagcgaaggaaatcatcgacccgaggccctacgccgtcggctccatcgtcgagacctacaagaagt acccgcacctcgacgtcatcctccctgctatgggctacggcaagaagcagattaaggagctcgaggagaccatcaacagg gccgatgccgacgtcgtcatcatgggcaccccagttgacctgcgcaggttcatgaacctcaacaagccagccgttcgcgt ccgctacgagctcgaggaaatcggccagcccaagctcaaggacatcctcgagaactgggtcaagaactgcgagaagctta agaag TGATTCCCGGAACGGGAAACCCTTTTATTCTCTTCTTTCGTAATCTTGTACAGGTGATCCTATGGCAATGGTAC TCGCATTTGTCGGGATAGTTTGGTTGTTGGGCATACTCAGCCTGATAGCAGTGATTTGGGTGATATACGATATCGTGACA AAACAGAAGCGCATGCCGGATACGGAAAAGTTGATATGGATCCTTGTGGCCCTCTTCCTTAACATAATCGGGGCGATAAT ATATTATCTCGTTGTCAAGGCCAGCGGCAAATACGAGGAGGCTCCGGAGGAAAGGTTTGAAGGCCTAGATAATCCGATTG AGATCTGACCGGAAGCCTTTTATGTTGAAACGCCTAACCCAAATCGCCCGGGGAGCACCGCCGAGGGCGGAGTCAATGAA CTCGGGCGGGTTATTACCCCCTTTTACGGCGTTTTTGGAGGTTCAATACTGGAACTGAGGGCGTCTCTTTGGAATTATTC CTGAGAAGCGCATCTTCACCATCCA