

>tg2112 Phosphoadenosine phosphosulfate (PAPS) reductase related protein

>tg2112 Phosphoadenosine phosphosulfate (PAPS) reductase related protein

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 2002185 - 2004444 (Additional range around tg2112 is :500nt.)

>Thermococcus gammatolerans EJ3 TTGATGCCGTTCCTGAGGTCATTGAAATCGCCCTGGAAAAAGCCAGAAGGCTTAACCTGAACGCCTGTTTTGAGGTTGCC GACGTTGAGAAGCTTCCCTTTCCCGACGGCAGTTTTGACACCGTTCTGAGCTCCTTCGTTTTCTGCACAGTTCCAAATCC CGAGAGGGGAATGAGGGAAATCCTCCGTGTCCTGAAGCCCGGTGGAAGGGCTATTTTCCTTGAGCACACGAAGAGCGATT CAGCTTTACTGAATTACCTCTTCCTCCTCCCCCTGAAGTTGCCGTTGAAGTTGCTCCTCGATGACGATCCTCTCAGGGAG ACTCATAAACTGGTCTCGAAGCACTTTGAAATCGAGCGTGAGGAGCGCTATTACCGCGGAATCGTCCGTTTAATCGTCGC GCGGAAGCCTCAGTGAAGCCGGTTTCATTATGGCTCAGGTTAGGGAGTTCTCCTCATCGGCTGGAAGACTTTTTAAGTTG CGCCCTTTTAACTACTACC atgttcacactcatagcccgagccagaaaggatgcgaaggccctgcagtacataaacgag aggaactacggcggttttttgaaggttgagagcctcggtgggggaaggaccaaggaagaagtccttgagaaccttgagag agccctcgaagggccttacatcccccttctcctcctcggtgagaaggagagggatcttatggaggagctccttcctgttt tgagggaatcgggaaagcccttttacgcgagatccctccgaacgaagcgcgtcaggaacatgcgcgttgatgagctttac tctcatatcgaggagatcaaggcccgctttaggttgggtttcaggtgggaagagggctacgcgctcgacccgcagaaccc attgggaatagagctccaccccgattacgatgtatacctggctgttggtgagggctttagaactgccatgagagaactcc tcggccttgaactcggtgagaactccctcgttctcaggaagcttatgaacagggagacctactactccggcccctatgct gttgcggaagtcagcaagaagctcggttttccgacggaaattctctggaggatcccccactcggagaacgtttcccttcg gcgcctcattgaactcaaccgggattatattgaggcttttgcaggagcctctaaggagttcctgcgccagtttgagggcg gtgacgttctcgtgccttggagcgggggcaaggactcaactgccgcgttgatcttggccagggaggtcttcggggatgtg actgcagtctacgtcaggatggagtacgagatgcccctgaccgatgaatacgttgagagaaccgccaggaaaatcggcgt ggatctgatccgcgtcgacgttcccatgccaatcgagaagtacggcatgcccacccactcaaacaggtggtgcacgcgga agaaagttgaggcactctactccgtcgcctctcaatttgaggatccagttctcgtactcggggacagggatggggagagc gcaaggagaaggctcaaaccgccggtagttgagagaaagaccgagttcgggacgtttctcgaggttatgccgataaaatt ctggagtgggttcatggttcagctcttcgttctggagaggggtcttgagcttcatcccctctattacgagggattctacc gccttggatgcacgatctgcccaagccttgccgactgggagatacaactgctcaaaaggagggagtggaggagctcccct TAATCCCTCCTCCGGAGCAGGGGTAGGAGCGCGAAGAGCGCTATTATTCCCGGCCCGCAGACTGAGGTTATTCCAACGC CGGTGCTCGATGTTGTGCTCGGGGTTTTTGTGCCGGTTGCTTTCGTGCTCGACGTGGTCGAGGGCACCGTTTCACTTCCC ATAGGGTTGGTCCACGTTACCTCACTTGAGTTTATCTTCAGCAGGAAGACACCTGCGCTTTCTCTCGCGTACTGATAGAA TATCATTGCGTTCTGGATGTCGTCTATACCGTTACCCTTCTCGTAGCTCTCAGCGAACTCGTAGTACGCCATCGCCAGGA GTGGGGTTATCCCCTTCATCTGGGCGAGTCCTATGGCCGTTTTGGCTGCCTCTTTCATCTGCTCCAGCTTGTCCCTGAGC ACGGTAACGTTGTCTATGCCTAGGGTGTCGAGGAACACTTCGCCCCTAACCCTGGCCTCCATAGCCGTGAATATCGCCGC CGAGTATTTTCCGTCGTCGTA