

>tg2124 Metallophosphoesterase, calcineurin superfamily

>tg2124 Metallophosphoesterase, calcineurin superfamily

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 2009981 - 2012813 (Additional range around tg2124 is :500nt.)

>Thermococcus gammatolerans EJ3 TATGTACATGCTCAGACGGTCGAGGCGGCCCGGGAGGGGACGGTTCTGATCACCACTTGTCCTCGGGTATTGCTTCCTTC TTTGCTGGGATCAGGCAGAGGAACTCGAAGGTCTCGCTCAAAGCCTTGTAGCCGTGGGGCTCGTTGGGCGGGACGTAGAG GAAATTTCCGGCCTTGACGTGGTGCTCCTCCTCTCCGTTGGTGATTATCCCTTCTCCCTTCAGGATGAATATCTCATGCT CCCAGTCGTGCTGGTGTATCGGGATCTCCGAGTCCTTTTTGAGGACAAAGTAGCGCATGGCGAAGTTCTTTGCCCCAAGC TTGGGATAAACGAGCCACCTTATCGTTACGCCCTCAAAACCCGTCTCCTCCTCGGGGACCTCAAGGTAGTGTCCGACGAA CATGGTATCACCGTTTTAACTTTCTCGGGCTGGTATTTAGACTTTGTGCATACCAAAGCCTTTTAATCCCGGTTCGTTTA TCCAATTGGGTGAACTTTC gtggaaagaaaggtgctggcggtgctccttttgggagttttccttctgggaacgatcgcg gccggctgcctcggcgggggcggtgaaaagagccaaccaacaacgagccagcagattggttcttccaccacaacaaccac gcacggaaccacaactcccacaacttctccaacaacgacctcggcatcttcagctaccactacgaccacctccagttctg aaaggacaacgaccaccacaacaatatcgagcacaacgacgaccacagccaccattcccacaactacaacgacaaccacg acaacgccaacaccggcggccgttaagatagacttctccaagttcagaaagaccgggcaggttatcggtgagtggaggac tatcttcaaaggccagccgatctacaccgttccagggtacttcgatctcgtcaaggcgtacttcccggacgccgaggtca gggacctctccgactacaggtgggggatagcggttctcccgccggagctggcagttaaggagctcgatggaaagagggtt agggttgagaaggttgactacttcggctacgttgcttacaggaacggctaccacttcgttggccctgacaagggaattat agcggtcttcaactccgaagagggggcgaagctcatccttaccggaacgagcagggccggcgttggtctcgccctcagag agctctcgcggattcattcttactcagacgtcccaagcctctacgtcctccgttccggccagttcgagggcctcttcctc aaggagatcggcgacgtgaactggaacggtatcgtcgagagaaccgagttcgttgaggactatcctctctactatgagga gcccttccattactactggcgcgtcgtcaaaggtgaaaacgtgacggtcagtgggggcttcataaggcttgtgaacggat ccaccgtttacatacgggcactcggcttcaacgtcagcgtctcggttaagccttccggggccgagcttacctacgtcatt gagaacatcaacccggcctacgtggactatcctaagtgcgccgaggtcggagagacgtggataaagctcaactcgacatc gggcttcactctgcgcccgagggaggtttctaactacaccgtcttcgcgctgggcgatcacagaccggcccacaggaacg acccggttccgagtgttttcctcaagataatggatcaggttaacaacggaagcggggcctttgtgatcgacggcggtgat ctggtctattccggcaggcttagcgagtgggtcgacctcatgaaggtctggaagtggaacaagcccgtattcctgacccc cggcaaccacgaataccagggcgagggcaagaacatattccactacctcttcggtccggacgaggactacagcttcgttc tcggagattacgtctacgttttcatgaatgacgtcgagaacggctacaccctcagctcacaccagtgggaggccctcaag gccgcccttgagatggccaacgaaaccggaagaagggccgttatcgtcatgcacgctccgccctacgatccgaggcctaa cggggatcacagcatgaaccacaactccgccgagaagctcttagctcttatgagggagtacaacgcgttcggaattttca gccacatccacctcaactggtatggggagcatgagggtgtgcagatgatcataacaggcggtgcaggggcccctctatac gttaccgatccgaacgaggggggcttttacggctatgcgatgctctcgatgggccccggtggggagatcgaggtcaaact cgtcagggtcgag TGACGGCCAAAAAGTTTTTATTTACTTTTTTCCTTGTCCCTCCAGAACGGGCTGTTCTAAAAATGA GGAGAGGGGTAAGAGCGATGCCAACGGTCAAAGTGGATCCAGAAGAGATAAAGAGAATCAAGAAGGAAATCGAGGCCCTT GAGAAGGAGAGGAACGAGATAAGGGCCAAGCTCGAGGAGCTTGAAAAAGAGCTCCAGAGCTGGATTCAAAAGAGGGACGA GAAAAACAGGGAGGTGCAGCAGCTCCGTCAGAAGGGCAGGGAGTACAAAGCTAAGAGGGATGAAATCAACGCCCAGATAA AACAGCTTAAGAAGAACCGTGAGGAGATCAACGCCAAGCTCGACCTCCTCTACCAGGAGATACTTGAGTACAGAACCAAG AGGGACGAGTACAACCAGCTCAGAAGGCTCAACATGCCTGCCGAGAAGATCAAGGAGAGAATCGAAAAGCTCGAATGGGA GCTCCAGACCAACCCCAAGATCACTCCAGAGAGG