

>tg2132 Alpha-amylase (amyA)

>tg2132 Alpha-amylase (amyA)

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 2017034 - 2019998 (Additional range around tg2132 is :500nt.)

>Thermococcus gammatolerans EJ3 ACTGAAGCTCAGGCTGATCAATCCTGATGTCGTGACTGGAATTGAGGTTCTTGAGCGGCACGTGATGGACATAGAAAGAG AGCACGAGCGCTTGGGCGTTGCGGCCCACATATACTTTGCCCTCGCCTCCCTCATAGTGGTATACTTCTTCACCGAGAAC GTGGCGATAGCAGCCGTTACCGTCGCAACCCTCGGCGATGCAATGGCGGCGATAATCGGGAAGAACTTCGGTAGGCACAG GTTTTCCAACGGTAAGAGCCTTGAGGGCAGCCTGGCATACTTTCTCTCCGCTCTGCTTGTTATATACCCCCTCCTCGGTC TCAAGCTCGCGATAGCCGGTGCTCTCATAGGCACTCTCGTTGAGTTCTACGGCCTACCTCCGGACGACAACTTTTCAAAC CAGGTCTGTGTGGCTTTCGCGCTCTACCTCTTCTCCCTGATCTGAGGGAGCAAAGTATTTATAGCCAAACCACTGTATCA CCTTTAGTGATAAGTACGG gtggttgccatggtcaagtttatcttcgggatacacaatcaccagcccctcggaaacttc ggctgggtttttgagagtgcctacgagaggtcatacaggccgttcatggaggcacttgaggattacccctccatgaaggt agccgtccactattcgggtcccctgcttgagtggctcgtcgagaacaggccagagcacattgaccttctcaaaagcctcg tcaggaaagggcagcttgagatagtcgtcgcaggcttttacgagcccgttttggcggcgatacccaaggaggacaggata gagcaggttagacttctcaaggacttcgcgaaaaagctcggctacgaggcaaggggcgtgtggctgaccgaaagggtctg gcagcccgaactcgtcaagagcctccgccaggcgggcatagagtacgtcatagttgatgactaccacttcatgagtgctg gccttcccaaggagagcctttactggccgtactacaccgaggacggcggcgaggtcataacggttttcccgatcgacgag agactgcgatatctaatccccttccgtcctgtggggaagactctcgactacctccactctctcgacgacggtgatgagag caaggtggcagttttccacgacgacggtgagaagttcggggtctggccgggaacctacgaatgggttcacgagaagggct ggctgagggagttctttgacgccgtttcgagcgatgaccggatagacctcaccctttactctgagtacctaaagcacttc aaaccgcggggcctcgtttaccttccgatagcgtcctacttcgagatgagcgaatggagcctcccagcaaagcaggcgaa gctcttcgtcgagttcgtcgaggagctcaagagggagaacaagttcgaccgctaccgcgtcttcgtcaggggaggaatct ggaagaacttcttctttaagtatcccgagagcaactacatgcacaagaggatgctcatggtgagcaagctggtaagggac aaccccgaggcgaggcggttcctcctcagagctcaatgcaacgacgcctactggcatggagttttcggcggaatatacct cccccacctgaggagggcggtctgggagaacatcataagggccaacagcttcgtttccactggaagcttcgtccgcgaca tagacttcgacggtagagatgaagtttttctcgagaacgaaaacttctatgccgtcttcaagccagcctacgggggagca ctctttgagttcagctccaagagaaaggccgtaaactacaacgacgtgctcgccaggagatgggagcactaccatgaggt tccagagtcggcaacccccgaggacgaaagcggggagggagttgccagcatccacgagctcggcaaaaggatcccggagg atataaagcgtgagcttgcctacgatgatcacatgagggcaatattgcaggatcacttcttcggtagggatgtggggcta aacgattactacctgagtaattacaccgaactcggggacttcctcaccggagcctacgacttctcgatctttgagggggg catcacccttgagcgtgatggtatagtctctggaagcccggcgagggttgcgaagtccttccgtctcacagataacggct tcattgttgactacaccgtgaggagtgaagccaaggcgctcttcggtgtcgagttgaacttagcggtgcacagcgtcatg gaaagccccggagaattcgaggcggatagctttgaggtaaaagacccctacgggattggagggctcaaaatcgagctcga taggaaggcaagggtgtggaagtacccgataaagaccctcagccagagcgagagcggctgggacttcatccagcagggtg tcagctacactctcctcttcccgcttgagggggagctgaggtttaggttggtgtttgaggaactt TAATTCTTCCTTTT GTGTTCTAGGCCCCCTAAAATTGAGGATAAATCAGAACCTGAGAACCATATCCTCAAGGTCGGGCGTTACGGACTTGATG ACGTGGAATTCCGTTGTCTTCCCCTTCTTTGATACCCTTATCACAGTGGTCGCTATGTCTTCGAGAAGGGCAGTTAAGGA CTGTCTCTCGGGTCCTATGATGCCAGTTTTTACAAGGTACACGGTCAGCCGTCTTTCGTCCCCGACGTATTGGGACATCA GTTTTACCAGTGCATGAACGTTTGCTGATGAGAACTCTGAAGCCATAAGGAGCTTCTCTAGGCCGAGGACTATGGTGAGC ACCGGGAATCTGGACTCAAGAACCTGCTCGTAGACATCCTTGAATTTCTTCGTCAGTATTACGGGCTCCGAGATCTCCTC GATGGTCTTTATCACGTTGCCAGTTTGCGTTCTGCCTCCGATCTTTATTACCTCAGCTTTGGTTAGCACATCAGTTTCTA TACCGG