

>tg2145 Glycosyltransferase, family 1, putative

>tg2145 Glycosyltransferase, family 1, putative

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 2030844 - 2032983 (Additional range around tg2145 is :500nt.)

>Thermococcus gammatolerans EJ3 ATTGCGAGCCCAAAATCCTTGAATGCCTTTTTACCTGACTCTTCCTCGATTATAGGCTTGACGACGTTCTCGGTTGTCCC GGGGAGAACAGTACTCTTGACGACTACAACATGATAGTCTTTCTTCTCGCGGAGGACTTTTCCAATTTCCCTCGAAGCCT GCTCGACGTAGGTTAAATCAATAGATCCGTCTTCTCTCGATGGCGTTCCAACGGCGATGAACGTAACCTCTGAGTTCAGA ATTGCATTGCGGTAATCCTTGGTTGCGCGGTACTTTCCTTTGAATTCCCTCATAAGTTCCTCGAGGCCTTCCTCATAAAT TGGTGGTTGGGCATTGTTTATCATCTTGATTTTTCTCTCATCAACGTCCACGAAGATAACTTCATTCCCCAGCTTGACAA AGCCCATCCCAGTTACGAGGCCGACGTAGCCTGAACCGATGACCGAAACCTTCATTATACCCCCTCCATTACGGTAGATG AGGGGCGTTCAATAAAAAG gtgatggtaatggatgggaaaaaagtgttcatgttgcttacgaacccttttaagcctgat cctcgcgtttacaaagaagccaagactctaatcgagctgggttttgatgtgacagttgtagcgtgggacagggagagaaa tcataaacttttcgagattgtggagggggtgagggtttgcagaatcccgatcgcatccaaatatgcgtccttttttgact ttttcattaagcttcccttgttttatctaaaagccgtgttgtacgtggtaaaaaataaggatggactttatgctatacat gcgaacgattttgataccgcaccgctggccttctttttgtcccgtcttcttggagtaaagttcatttatgacatccacga tctgtatcattctaggatttcattgcttagggaaaagaaaaccttgaacttcttgcagaggttaatcctttcgcttgaga tcatccacgctaagctggccgattctgtgataacggtaaccagatccttagggggacgtcataagggtgttaaagagttc cttgtaaacaggggagttgtgcctgacaaagtttatgtggtctggaacactcctgagcttgaattctttcctctgattaa acgggaacgtggagaaaagtttacagtgggatacattgggacaatacgaagtgtttcaagctttattccgctctttgagg ttgctcggagggacagaagattgaaattgctctttgttggctcgggggcttccaagggtaagattgctaaccttctaact gagaggtatcccaacgttgatgttgagttcatcgatgaggttccctatcataatgtcttcaagtattacaccctctgcga tgctgtctattcaatgtaccctcctacggataacatcaagcgggcgctcgcggtcaagatgtttgagagcattgtgatgg ggattcctgtgatagtgaatcgggacaccttgatggaggatttcgtagttttgtaccggtgtggggtttcatctaatctc tcaacggaagatatggcgaatgctttggagaaaataataaaagtaaagccaccatcacgtcttagggataagtggaattg ggataggaacagaagcacattgaggagggtctattgtgag TGATCTTGAGGATACAAATAACAAAAACGATGAGTTCCG AGAAGGCTTCGAGGATAAAAATCTCCTAATCCTGACAAATTCGTATCCCGATGAGGACAACCGGCACTACGGCGGGATTT TTGTTAAGAAGCAGGTCAGATATCTTGCCAGGTATTTTAATGAGATCTATGTAATCTCCCCCCAACCTTATGGCTCTAAC AGGAACCTCCGTGATTATGAGCACGACAACGTTAGAGTTTACTACCCGAGGTTCTTCCACCTGCCCGTTGAGTTCTTCAG AAAACGCCTCGGTGACAATTTAACTTGCCTTGCTGTATATCTCTGGCAGTATCAATACGAGAAAAAACTTAAAACGTTTG TATCAAACCTTAAAAGAGACTGTTGCGTTGGGAAGATTGTTACCTACCAAGGGGGGATAAACAGTGGATGATGTTAAAAT TTTTTTGAGGTATAATTATGGATTTAGATGGTATAATAAAAATGGTGTTTATGTTAAGGGG