tg_HgcFRNA

Coordinates:945780-945980

>tg_HgcFRNA Non coding HgcF RNA
accgctcgcacgggtggatgctcccggccctgtgggctcggcgtgagcacgctccgttca
tcgaacccgagcacctcacggaggcgggtagaccgagcccgtgcgaggggtattgtcccc
ccgctgtcggcgatagtgattaccagccgggggtttaaaagattgtgggctcctcaattg
gcagctcgctgctctccttgt
>tg_HgcFRNA Non coding HgcF RNA
accgctcgcacgggtggatgctcccggccctgtgggctcggcgtgagcacgctccgttca
tcgaacccgagcacctcacggaggcgggtagaccgagcccgtgcgaggggtattgtcccc
ccgctgtcggcgatagtgattaccagccgggggtttaaaagattgtgggctcctcaattg
gcagctcgctgctctccttgt


Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 945280 - 946480 (Additional range around tg_HgcFRNA is :500nt.)

>Thermococcus gammatolerans EJ3 TCCGAAATCTCCTTCTCTATTTCGTTTATCCTCTGTATTATGCTCTCCTTTATGCGTTCTATGAGCTCCTTCGGGGAGGC GGCGGTGTAAACGTAGCCGAGCCAGCCCTGTTCGATCAGAGTTCTCTTAAGAACTCCCTTCCGGTAAAGGTTGAGAACGT GCTCCCTAACCGAGCGCTCGCTGAGACCCAACTCCCTCTGTATCTCCGTGATTCTCATGGGCCTTTTCTTCTCGAGCAGA AGCTTGTACACCCTGAGCTCCGTTTTCTTGAAACCGAGGCTCCTGAGCAGTCCTTCCAGCTTCTCGTAGACCTCGTCCCT TGCAACCATGCATTCACCTCTATGAAGTTTTTACTTCATGGCCCTTAAAAGGCTTACGGACTTAAGGGTTTTTGTGGAAA GAGTTGAGAAAAGGCACAAAGTTACTGAAAAAGATTTCAATTTTTAGGAGTTTCCCCGAAAATTGTCTGAGTGTGGGCCG GGCACAGAGGCCCGAGCTC accgctcgcacgggtggatgctcccggccctgtgggctcggcgtgagcacgctccgttca tcgaacccgagcacctcacggaggcgggtagaccgagcccgtgcgaggggtattgtccccccgctgtcggcgatagtgat taccagccgggggtttaaaagattgtgggctcctcaattggcagctcgctgctctccttgt GAACCTTTAAGACGACCA TCGTATGGGTCGATTCAACGCCCTCTATATCCCCTATCGCGTCGAGGAAACGGTTGAGCTCATCGCTGTCCCTGGCCCTT ATTTTAACTATCATGTCGTAATCTCCGGTAGTCTCGTAGACCTCTACTATCTTGGGGTACTTGCTGAGCTCTTCCGCAAC CTTGGCATACATCCCCGCTTTCGTCTTTATCAGAACGAAGGCGAGCATTCCCAGGCCGAGAGCTTCAGGATTCAGAAGAA CGGTAAAGCGCCTGATTATCCCCCTCTCCCTCATCTTCTTGATTCTCTCGTAAACGGTCGATTCCGCGAGGCCAACTTCC TTGGAAATCTCCCTCAGGGAGGATCGGCTGTTTTTCTGCAGGATCATGAGTATCTTCCGGTCTATCTCATCCATTCTACC GCGCATGGGAACCACCCCTAAAAAATTTTCGAAAGGATATATAAAGTTGCCGATCATCAAAAGGCCATACTTTTATAAAA TC