tg_rep10_b

Coordinates:1221345-1221374

>tg_rep10_b repeat element in cluster B
GCTTTCAATTCTCCTAGAGTCTTATTGCAA
>tg_rep10_b repeat element in cluster B
GCTTTCAATTCTCCTAGAGTCTTATTGCAA


Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1220845 - 1221874 (Additional range around tg_rep10_b is :500nt.)

>Thermococcus gammatolerans EJ3 GGCTGTTTGAGAGGAGGAAAATTGAAAATCTTCCCTCGAATACGGCTGGAAATCAATTTTTGTTGTTTTAAAATTGTTAC TTATTGTTACATATTCCCGCTTGAACTGTAACGAATTTTCTTCGAGAATTGAAACGGAGCTCGTCAATCCCCCAGATAAT GCCATAACCTGTGGAAAATGATGTTATTTTAGATTCAACATCTTTAATCGTCGATTTTGGAGTTTAACGGCATCAAACGG ATTTGCATTTCTCAAACCGTTTTACCAACATTATAGGAAGGATTCTTCTGGCCACCATTTTGGAAATCCAGAGATGCACA ACGACTCCAATTGGAGGGGATCTGTGCCTTCTTTTCCAGAAGGTTTCCAGAAAAGCTTAAATATATGAGAACGTACAACC CCCTGTTGGGCAAACGGACGGAAAATCCGCCCTGTTGCAATAAGACTCTAGGAGAATTGAAAGGGAGATTGGTCAACTCT GGCTTGACTGGAGGGCTGGTGTTGCAATAAGACTCTAGGAGAATTGAAAGCGCGTAAATGAGGGCCGGGTAATTCGCGAG ATAAGCGTTGCAATAAGACTCTAGGAGAATTGAAAGATACTCAAAGCCGGCCCCAACAGCCCCAAAATAATCAGTTGCAA TAAGACTCTAGGAGAATTGAAAGCTGGATCTCCCACACGGCCTGGGCCTTCTCAACCTGCGTTGCAATAAGACTCTAGGA GAATTGAAAGTAGTTCTTAACGAAACTCCGCACCCTCCTCCTAACTCGTTGCAATAAGACTCTAGGAGAATTGAAAGTTG GGGTGCTCTACCTCGCTAGGACTGGCAAAAAGAGGGTTGCAATAAGACTCTAGGAGAATTGAAAGCTCATTGAATCCCTC TCAACCTCAAGGTACTCCTTCGGTTGCAATAAGACTCTAGGAGAATTGAAAGGACTTTGGTCGGGGCCCGCAAAGAGTAT CCGAACCTCTCAAGTTGCAATAAGACTCTAGGAGAATTGAAAGTTAAGTGTTCATGAATTGATACTGGA