tg_rep11_b

Coordinates:1221411-1221440

>tg_rep11_b repeat element in cluster B
TCTTTCAATTCTCCTAGAGTCTTATTGCAA
>tg_rep11_b repeat element in cluster B
TCTTTCAATTCTCCTAGAGTCTTATTGCAA


Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1220911 - 1221940 (Additional range around tg_rep11_b is :500nt.)

>Thermococcus gammatolerans EJ3 TTTAAAATTGTTACTTATTGTTACATATTCCCGCTTGAACTGTAACGAATTTTCTTCGAGAATTGAAACGGAGCTCGTCA ATCCCCCAGATAATGCCATAACCTGTGGAAAATGATGTTATTTTAGATTCAACATCTTTAATCGTCGATTTTGGAGTTTA ACGGCATCAAACGGATTTGCATTTCTCAAACCGTTTTACCAACATTATAGGAAGGATTCTTCTGGCCACCATTTTGGAAA TCCAGAGATGCACAACGACTCCAATTGGAGGGGATCTGTGCCTTCTTTTCCAGAAGGTTTCCAGAAAAGCTTAAATATAT GAGAACGTACAACCCCCTGTTGGGCAAACGGACGGAAAATCCGCCCTGTTGCAATAAGACTCTAGGAGAATTGAAAGGGA GATTGGTCAACTCTGGCTTGACTGGAGGGCTGGTGTTGCAATAAGACTCTAGGAGAATTGAAAGCGCGTAAATGAGGGCC GGGTAATTCGCGAGATAAGCGTTGCAATAAGACTCTAGGAGAATTGAAAGATACTCAAAGCCGGCCCCAACAGCCCCAAA ATAATCAGTTGCAATAAGACTCTAGGAGAATTGAAAGCTGGATCTCCCACACGGCCTGGGCCTTCTCAACCTGCGTTGCA ATAAGACTCTAGGAGAATTGAAAGTAGTTCTTAACGAAACTCCGCACCCTCCTCCTAACTCGTTGCAATAAGACTCTAGG AGAATTGAAAGTTGGGGTGCTCTACCTCGCTAGGACTGGCAAAAAGAGGGTTGCAATAAGACTCTAGGAGAATTGAAAGC TCATTGAATCCCTCTCAACCTCAAGGTACTCCTTCGGTTGCAATAAGACTCTAGGAGAATTGAAAGGACTTTGGTCGGGG CCCGCAAAGAGTATCCGAACCTCTCAAGTTGCAATAAGACTCTAGGAGAATTGAAAGTTAAGTGTTCATGAATTGATACT GGAAGTCGAAACACGTTGCAATAAGACTCTAGGAGAATTGAAAGAAGCGTTGTTATTTGCCTCATGCCG