tg_rep12_b

Coordinates:1221478-1221507

>tg_rep12_b repeat element in cluster B
GCTTTCAATTCTCCTAGAGTCTTATTGCAA
>tg_rep12_b repeat element in cluster B
GCTTTCAATTCTCCTAGAGTCTTATTGCAA


Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1220978 - 1222007 (Additional range around tg_rep12_b is :500nt.)

>Thermococcus gammatolerans EJ3 ACGGAGCTCGTCAATCCCCCAGATAATGCCATAACCTGTGGAAAATGATGTTATTTTAGATTCAACATCTTTAATCGTCG ATTTTGGAGTTTAACGGCATCAAACGGATTTGCATTTCTCAAACCGTTTTACCAACATTATAGGAAGGATTCTTCTGGCC ACCATTTTGGAAATCCAGAGATGCACAACGACTCCAATTGGAGGGGATCTGTGCCTTCTTTTCCAGAAGGTTTCCAGAAA AGCTTAAATATATGAGAACGTACAACCCCCTGTTGGGCAAACGGACGGAAAATCCGCCCTGTTGCAATAAGACTCTAGGA GAATTGAAAGGGAGATTGGTCAACTCTGGCTTGACTGGAGGGCTGGTGTTGCAATAAGACTCTAGGAGAATTGAAAGCGC GTAAATGAGGGCCGGGTAATTCGCGAGATAAGCGTTGCAATAAGACTCTAGGAGAATTGAAAGATACTCAAAGCCGGCCC CAACAGCCCCAAAATAATCAGTTGCAATAAGACTCTAGGAGAATTGAAAGCTGGATCTCCCACACGGCCTGGGCCTTCTC AACCTGCGTTGCAATAAGACTCTAGGAGAATTGAAAGTAGTTCTTAACGAAACTCCGCACCCTCCTCCTAACTCGTTGCA ATAAGACTCTAGGAGAATTGAAAGTTGGGGTGCTCTACCTCGCTAGGACTGGCAAAAAGAGGGTTGCAATAAGACTCTAG GAGAATTGAAAGCTCATTGAATCCCTCTCAACCTCAAGGTACTCCTTCGGTTGCAATAAGACTCTAGGAGAATTGAAAGG ACTTTGGTCGGGGCCCGCAAAGAGTATCCGAACCTCTCAAGTTGCAATAAGACTCTAGGAGAATTGAAAGTTAAGTGTTC ATGAATTGATACTGGAAGTCGAAACACGTTGCAATAAGACTCTAGGAGAATTGAAAGAAGCGTTGTTATTTGCCTCATGC CGATCCCCCCATGTTGCAATAAGACTCTAGGAGAATTGAAAGTTTGTCGGGGACTACTTCGTAATGGCA