tg_rep17_b

Coordinates:1221818-1221847

>tg_rep17_b repeat element in cluster B
ACTTTCAATTCTCCTAGAGTCTTATTGCAA
>tg_rep17_b repeat element in cluster B
ACTTTCAATTCTCCTAGAGTCTTATTGCAA


Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1221318 - 1222347 (Additional range around tg_rep17_b is :500nt.)

>Thermococcus gammatolerans EJ3 CAACTCTGGCTTGACTGGAGGGCTGGTGTTGCAATAAGACTCTAGGAGAATTGAAAGCGCGTAAATGAGGGCCGGGTAAT TCGCGAGATAAGCGTTGCAATAAGACTCTAGGAGAATTGAAAGATACTCAAAGCCGGCCCCAACAGCCCCAAAATAATCA GTTGCAATAAGACTCTAGGAGAATTGAAAGCTGGATCTCCCACACGGCCTGGGCCTTCTCAACCTGCGTTGCAATAAGAC TCTAGGAGAATTGAAAGTAGTTCTTAACGAAACTCCGCACCCTCCTCCTAACTCGTTGCAATAAGACTCTAGGAGAATTG AAAGTTGGGGTGCTCTACCTCGCTAGGACTGGCAAAAAGAGGGTTGCAATAAGACTCTAGGAGAATTGAAAGCTCATTGA ATCCCTCTCAACCTCAAGGTACTCCTTCGGTTGCAATAAGACTCTAGGAGAATTGAAAGGACTTTGGTCGGGGCCCGCAA AGAGTATCCGAACCTCTCAAGTTGCAATAAGACTCTAGGAGAATTGAAAGTTAAGTGTTCATGAATTGATACTGGAAGTC GAAACACGTTGCAATAAGACTCTAGGAGAATTGAAAGAAGCGTTGTTATTTGCCTCATGCCGATCCCCCCATGTTGCAAT AAGACTCTAGGAGAATTGAAAGTTTGTCGGGGACTACTTCGTAATGGCACACAACGGCTGTTGCAATAAGACTCTAGGAG AATTGAAAGAACTCGTAACTGAAGATGTTATAGTTGCTTCTATCGTGTTGCAATAAGACTCTAGGAGAATTGAAAGGAGT TGGTCGTGTGGGTTGGGGTTATCAGTGCATGCTTGTTGCAATAAGACTCTAGGAGAATTGAAAGTTCTTCTATGACGTAT TTATTGATTTTACTGATTATTGGTTGCAATAAGACTCTAGGAGAATTGAAAGGAGCGAGGTTGGGCATCTCCTCAGCGAC GGGAGTGGGTTGCAATAAGACTCTAGGAGAATTGAAAGAAGAGTGCACAAAAGAATACATTTCAACTAA