tg_rep1_a

Coordinates:208439-208467

>tg_rep1_a repeat element in cluster A
CTTTCAATTCTCTAGAGTCTTATTGCAAC
>tg_rep1_a repeat element in cluster A
CTTTCAATTCTCTAGAGTCTTATTGCAAC


Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 207939 - 208967 (Additional range around tg_rep1_a is :500nt.)

>Thermococcus gammatolerans EJ3 GTTGGGCGAAAGGGCAAATTTCGCGCCCTGTTGCAATAAGACTCTAGGAGAATTGAAAGGAAACCCAAATAGAAGATGTG AACCCCGCCGGGCAAGTTGCAATAAGACTCTAGGAGAATTGAAAGAAAAGGCGAGCAGAATTTACGCGAAGAAGTACGGA CAAGGTTGCAATAAGACTCTAGGAGAATTGAAAGGGATCCGGCGGATGCCATGCATGCGTCGGGGACGGCCTGTTGCAAT AAGACTCTAGGAGAATTGAAAGAGGCCGATGAGGGCAATGCCGAAGACCAGCCAACCCAGGTTGCAATAAGACTCTAGGA GAATTGAAAGGCTTTCCCTATAAGCGTCAATATCGACGTATATTTCCCGTTGCAATAAGACTCTAGAGAATTGAAAGGGA GTTCTGCTACCTTCCTCATCAGTAGTAGCGCGTAGTTGCAATAAGACTCTAGGAGAATTGAAAGCTTTTTTAGACTTGAC TAAGTGCTTAAACTCGAAGGTTGCAATAAGACTCTAGAGAATTGAAAGAGAATTGCTGTGAACATTGCCTGCATAATCAG GGCCGTTGCAATAAGACTCCCAGGGAATCGAAAAGCAATACAAAGCCGCAAAATATTTAATTCAAAAAGTCAAGGTAGAA ACATGAGCCTCAAAAGAAAAATCAAGTCCTTTGTAGAGGACTTTCAGATCTTAATCCTCATTATCGCGATACCCCTCCTC TTCCTCCTGTTCCGGCTGTTTCTCACCGCATCGTATGCACTGACAGGAGGCTACCTCCTCGGGATAATAGCAATCCTCCT TGTACTGTTTGGCATCGGATGGATCCTGAAGCCAGCGAGCGTTAAGAGACGCATCTAAACCTCAACCCACGTGAAGTCCC TCGCGACCTCGCCCGGAATCCCTGCTTCTCTGACCCTCTTCTCCAGAACCTCGTGAGGATAGTTGCTGTGGCTTATGTGC GCGAAGACTGTGTAGCCTGCCCCGACCCTCTTCGCCAGCTCTATCGCCTCCCTAACTCCAAGATGCGA