tg_rep2_a

Coordinates:208503-208532

>tg_rep2_a repeat element in cluster A
CTTTCAATTCTCCTAGAGTCTTATTGCAAC
>tg_rep2_a repeat element in cluster A
CTTTCAATTCTCCTAGAGTCTTATTGCAAC


Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 208003 - 209032 (Additional range around tg_rep2_a is :500nt.)

>Thermococcus gammatolerans EJ3 CCCTCGTGATCGTTTCAAGACCGATTTCCAGAAAGGCTTAAATATTGGGACGTTCTTATTTCTTCGTTGGGCGAAAGGGC AAATTTCGCGCCCTGTTGCAATAAGACTCTAGGAGAATTGAAAGGAAACCCAAATAGAAGATGTGAACCCCGCCGGGCAA GTTGCAATAAGACTCTAGGAGAATTGAAAGAAAAGGCGAGCAGAATTTACGCGAAGAAGTACGGACAAGGTTGCAATAAG ACTCTAGGAGAATTGAAAGGGATCCGGCGGATGCCATGCATGCGTCGGGGACGGCCTGTTGCAATAAGACTCTAGGAGAA TTGAAAGAGGCCGATGAGGGCAATGCCGAAGACCAGCCAACCCAGGTTGCAATAAGACTCTAGGAGAATTGAAAGGCTTT CCCTATAAGCGTCAATATCGACGTATATTTCCCGTTGCAATAAGACTCTAGAGAATTGAAAGGGAGTTCTGCTACCTTCC TCATCAGTAGTAGCGCGTAGTTGCAATAAGACTCTAGGAGAATTGAAAGCTTTTTTAGACTTGACTAAGTGCTTAAACTC GAAGGTTGCAATAAGACTCTAGAGAATTGAAAGAGAATTGCTGTGAACATTGCCTGCATAATCAGGGCCGTTGCAATAAG ACTCCCAGGGAATCGAAAAGCAATACAAAGCCGCAAAATATTTAATTCAAAAAGTCAAGGTAGAAACATGAGCCTCAAAA GAAAAATCAAGTCCTTTGTAGAGGACTTTCAGATCTTAATCCTCATTATCGCGATACCCCTCCTCTTCCTCCTGTTCCGG CTGTTTCTCACCGCATCGTATGCACTGACAGGAGGCTACCTCCTCGGGATAATAGCAATCCTCCTTGTACTGTTTGGCAT CGGATGGATCCTGAAGCCAGCGAGCGTTAAGAGACGCATCTAAACCTCAACCCACGTGAAGTCCCTCGCGACCTCGCCCG GAATCCCTGCTTCTCTGACCCTCTTCTCCAGAACCTCGTGAGGATAGTTGCTGTGGCTTATGTGCGCGA