tg_rep32_c

Coordinates:1857163-1857192

>tg_rep32_c repeat element in cluster C
TTTCAATTCTCCTAGAGTCTTATTGCAACC
>tg_rep32_c repeat element in cluster C
TTTCAATTCTCCTAGAGTCTTATTGCAACC


Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1856663 - 1857692 (Additional range around tg_rep32_c is :500nt.)

>Thermococcus gammatolerans EJ3 CGACGGCCCTGTTGCAATAAGACTCTAGGAGAATTGAAAGTAAGAGGCGCCGTCTACGTGGAGGGTGACCCCGGTTAGTT GCAATAAGACTCTAGGAGAATTGAAAGCAAGTACGCCCCAACAGAGCCCTCAGTCAGCGTCAGCACGTTGCAATAAGACT CTAGGAGAATTGAAAGGGCTTTGGCATCGAGGTAAACGTTTTGCACCCACCTGAAGTTGCAATAAGACTCTAGGAGAATT GAAAGAGTTCGGCCTCGTCGAGAACGTCGCTGATGAAGAGCAGGTTGCAATAAGACTCTAGGAGAATTGAAAGGTTTCTC CCTGTCAAGAACACTCATGTGCGGCTGGATCAAGGTTGCAATAAGACTCTAGGAGAATTGAAAGTCGCTTGAGCAGGGGT TAAGTCCTCCGCCACGATGACGGGCACGTTGCAATAAGACTCTAGGAGAATTGAAAGTAATGATATTTAGCAAGTCATTC ACGTTTACAGTCGTCCCCGGTTGCAATAAGACTCTAGGAGAATTGAAAGGCCACGTAGGCGTCGTAGCTCTGGATGTATG TTCCGGGTTGCAATAAGACTCTAGGAGAATTGAAAGGGGGGCCGAGGGCGGGTGGTTGTCGAGGTTCACGTCGACGTAGA GTTGCAATAAGACTCTAGGAGAATTGAAAGAGGAGTTTATCTTGAGGCGCCCTCATGTGAATTCACTTAAGATCCAAGCG CTTACAGAAACTCTTCAAACAGCAGATCCTCAAGCTTTCCTCCAGCTTTTTTGAAAATGCTCACGCTCCAGCCGACGTTT CCAACTTTTTCCGGCCTGTGGGCATCGCTGGCGAAGGTCAGCTTAACGCCCCTCCTTATGCACTCCCTCACGAACTCCAG ATCCGGAACGCGGTAGCGGGAGCTTATCTCGAAGGCCTTACCATTTTCCTCGGCGAGCGTTATGAGCTCCAAAAGGTCCT CCCAAGGAGGATAACCTATGTAGGGAAAGCTTGCCCCGAAATGGCCTATTACATCGACGTTCTCGTCGA