tg_rep9_a

Coordinates:1221307-1221278

>tg_rep9_a repeat element in cluster A
CCTTTCAATTCTCCTAGAGTCTTATTGCAA
>tg_rep9_a repeat element in cluster A
CCTTTCAATTCTCCTAGAGTCTTATTGCAA


Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1220807 - 1221778 (Additional range around tg_rep9_a is :500nt.)

>Thermococcus gammatolerans EJ3 CCTTTCAATTCTCCTAGAGTCTTATTGCAACCGAAGGAGTACCTTGAGGTTGAGAGGGATTCAATGAGCTTTCAATTCTC CTAGAGTCTTATTGCAACCCTCTTTTTGCCAGTCCTAGCGAGGTAGAGCACCCCAACTTTCAATTCTCCTAGAGTCTTAT TGCAACGAGTTAGGAGGAGGGTGCGGAGTTTCGTTAAGAACTACTTTCAATTCTCCTAGAGTCTTATTGCAACGCAGGTT GAGAAGGCCCAGGCCGTGTGGGAGATCCAGCTTTCAATTCTCCTAGAGTCTTATTGCAACTGATTATTTTGGGGCTGTTG GGGCCGGCTTTGAGTATCTTTCAATTCTCCTAGAGTCTTATTGCAACGCTTATCTCGCGAATTACCCGGCCCTCATTTAC GCGCTTTCAATTCTCCTAGAGTCTTATTGCAACACCAGCCCTCCAGTCAAGCCAGAGTTGACCAATCTCCCTTTCAATTC TCCTAGAGTCTTATTGCAACAGGGCGGATTTTCCGTCCGTTTGCCCAACAGGGGGTTGTACGTTCTCATATATTTAAGCT TTTCTGGAAACCTTCTGGAAAAGAAGGCACAGATCCCCTCCAATTGGAGTCGTTGTGCATCTCTGGATTTCCAAAATGGT GGCCAGAAGAATCCTTCCTATAATGTTGGTAAAACGGTTTGAGAAATGCAAATCCGTTTGATGCCGTTAAACTCCAAAAT CGACGATTAAAGATGTTGAATCTAAAATAACATCATTTTCCACAGGTTATGGCATTATCTGGGGGATTGACGAGCTCCGT TTCAATTCTCGAAGAAAATTCGTTACAGTTCAAGCGGGAATATGTAACAATAAGTAACAATTTTAAAACAACAAAAATTG ATTTCCAGCCGTATTCGAGGGAAGATTTTCAATTTTCCTCCTCTCAAACAGCCTTTTTTGAAAATTGAAGAACTTCTAGC GTGATATGTCA