tg_tRNA-Gln2

Coordinates:476385-476460

>tg_tRNA-Gln2 tRNA-Gln (CTG)
AGCCCCGTGGTGTAGCGGCCAAGCATGCGGGACTCTGGATCCCGCGACCGGGGTTCGAAT
CCCCGCGGGGCTACCA
>tg_tRNA-Gln2 tRNA-Gln (CTG)
AGCCCCGTGGTGTAGCGGCCAAGCATGCGGGACTCTGGATCCCGCGACCGGGGTTCGAAT
CCCCGCGGGGCTACCA


Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 475885 - 476960 (Additional range around tg_tRNA-Gln2 is :500nt.)

>Thermococcus gammatolerans EJ3 GGTTTCTCTAAGAAGCGCTCCTTTGGAGCGCGGGAAAAAGTAAACCCACGTGAGAAAGCTTCTAAAATCTAAGAATTCGC ATTTTACACGAGTCCATTAAAAGCGCAAACACTCTCAAAGTGACGCTGCTAAAAGAATCACAACTTTAATGAAACTTTGC CCAGCAAAGTTTCTTTGGTGAAGCTTTTTCCAAAAGCTTCAGTGCTGGCGGAAGAGTGAGTGCTTTTTAGAAGTGCAAGT TTTAGAAGGGGTTTCTACTAAATTTGCTCCTTCTGTGGGGTTTTACTTAAGAATGCGCCCTTTGGGCACCGATAGGGAGT TGTTGAAGCTGTCTTGATGGGTTTCTCTTTTGTGGTAAACCCGTTTAAAATTATCCAGTTCTCCAGTGCACAGCTAATTT TTGCCCGTTGGTGAGGGGGGCATTTTTGGTCAAGCTTTGCACAAGCAAAGCTTGTGGGGGTAAAATTTATAAATCCATCC CGGAACCTATCAACGGGCAC AGCCCCGTGGTGTAGCGGCCAAGCATGCGGGACTCTGGATCCCGCGACCGGGGTTCGAA TCCCCGCGGGGCTACCA TTCAACTGGGCTCCAGACGAAATTCGAACCCCATGTTTTACTCTCATTCCTAAATTTAACAG CTGGACATTCAGCCGCACTTTTTCAGTATTTCTCTTTCTCTGCTCAACATACCTCCAAAATGTGGGTTATTTTCCAATCT TTTATCTATGCTGGATTTCTTCAGGGTTGCACATTCCTATGATTTATTTTAATTTCCAGCTGGGAGACAGCATTTTTGTC CGTTAGTTTTTTTCTAGCCTTTTTTGATCAATCTGAAAACTTTCAATTGAGAAAATTCAAATTCAAACTTTCTAGGAAGC TTTTTAAGGAGAAGAACACAGAATAGGTAAATAGAAAGTTATTCAAGGGGCTGGTAATATGTCCAATCCGGACTGCTCTA ATCTGAGGGATATCGGGAGGTTTGATAATGAACGAAAATTTGAAGTTAGAGTGCGAGATCAGGAACCTCCTGAGATTGAA GGGACCGTTAAGCGTCGCTTTTATTACAAGGTTCTTG