tg_tRNA-Leu3

Coordinates:1834144-1834231

>tg_tRNA-Leu3 tRNA-Leu (GAG)
GCGGGGGTTGCCGAGCCTGGTCAAAGGCGCGGGATTGAGGGTCCCGTCCCGCAGGGGTTC
CGGGGTTCAAATCCCCGCCCCCGCACCA
>tg_tRNA-Leu3 tRNA-Leu (GAG)
GCGGGGGTTGCCGAGCCTGGTCAAAGGCGCGGGATTGAGGGTCCCGTCCCGCAGGGGTTC
CGGGGTTCAAATCCCCGCCCCCGCACCA


Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1833644 - 1834731 (Additional range around tg_tRNA-Leu3 is :500nt.)

>Thermococcus gammatolerans EJ3 AAGTGCCAGCTCTCTGGTGGGGGTGAGTATTATGGCCTGCACTGTTTTTTCGTTGGGGTCGATTGCCTCTATTATAGGAA GTGCAAACGCCGCAGTTTTCCCTGTTCCCGTTTGGGACTGGCCGATTATATCAACCTCCCCCTCAAGGAGGCGTGGGATG ACTTCCCTTTGAATGTCCGTTGGGACTTCAAAACCCTTCCTTCTAACTGCCTCTAAACTTGATTCTGACAAGCCCAATCT TTCAAAACTCATCTTTACAAACTCCCTTACTTTGCTCAGACGCACTCCTTCTCAGGCGGAACGCGTCGAGAAGAAACGCG ATCTGGCGGGCCGGGGGGGATTTGAACCCCCGACCTGCGGATTAAGAGTCCGCCGCTCTAACCAGGCTAAGCTACCGGCC CTCAACCCGAAACCATAGACGGGAGTTGATTTATAAATTTTTTGGTATCTCTCGAGGGAAAACTTTATAAATCCTCCTCG ACCCTTATAATTGGCAAC GCGGGGGTTGCCGAGCCTGGTCAAAGGCGCGGGATTGAGGGTCCCGTCCCGCAGGGGTTCC GGGGTTCAAATCCCCGCCCCCGCACCA GAAACGAAACTTTTGCCAAGCAAAAGTTTCATCAAAGTTCGTGATTCCTTTT TGAAGAGTAGTTTTTGAGTGGATTTCCCCCAAATTGCTCCTTTGACTGAACGAATTCATTTAAAAGCACCTTTTAGCTTG GGTTCAAGCTTTTTTGCGCTCTGGTGGGGCGCGGTTCTACCTGAACCGCGCATAAAAAGCCTTAACTTGGTGAATTCAAA CTTTCAATAGCGGGCTTGATTTTGAAATCCTATTACAAAGGAGCCCAAAAGAGGAATCACGAACTTCTAGCCAAACTTTT CCCAAAAGCTTGCCTGCGAAAGCGATTTAAATCGCTGGATCATGAAGATAGCGGTGGTGGAATGAAGGTTCACTACGAGT GCTTCTCGTGCATTGCCAGTCAGTGTCAAAAGATTGTCGAAATGGGAACCGAAGACCTTGGTGTCAGGAAGAGAGGTATT TTGAGGGCCGCGAAGGGGATAGCTGAGATGAAAGAAGACTCCATACCCG