tg_tRNA-Leu5

Coordinates:1884314-1884398

>tg_tRNA-Leu5 tRNA-Leu (CAA)
GCGGGGGTTGCCGAGCCTGGTCAAAGGCGGTGGACTCAAGATCCACTCCCGCAGGGGTTC
CGGGGTTCAAATCCCCGCCCCCGCA
>tg_tRNA-Leu5 tRNA-Leu (CAA)
GCGGGGGTTGCCGAGCCTGGTCAAAGGCGGTGGACTCAAGATCCACTCCCGCAGGGGTTC
CGGGGTTCAAATCCCCGCCCCCGCA


Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1883814 - 1884898 (Additional range around tg_tRNA-Leu5 is :500nt.)

>Thermococcus gammatolerans EJ3 GGCCCGGTATGGTCTACTCCGGTGATCTTAAAAGCGATGATGAAGGGGTCAAACCTGCCAACCCGAACATTCCAATAGTC AAGCTCGCCGAGGGGCAGAAGCTTACCTTTAACGCTTACGCCAAGCTCGGTCGCGGCAAGGATCACGCCAAGTGGCAGCC GGGTTTCGTGTATTACAAGTACCTTACCGAGATACATGTAAGCAAAGAAGTCCCCGACTGGGAGGAGCTTAAGGAACTCG CCGAGAGGCGCGGATTACCCGTTGAGGAAAAAAAAGACGAGATAATCATAAAGACCATCAAGGCCTTCTACCTCCCGAGG AAGTTCGAGGCCTACGAGGGCGACAAGATCCGTGAAGAGATAATACCCGGGGCGTTCGTCTTTACCGTGGAAACGAACGG AGAGCTCCCCGTTGAGGAAATCGTGAGCATAGCGCTCAAGATACTCATGAGGAAGAGCGATAGATTTATAAACGAACTCC ATAAATTAGCCGACTGAC GCGGGGGTTGCCGAGCCTGGTCAAAGGCGGTGGACTCAAGATCCACTCCCGCAGGGGTTCC GGGGTTCAAATCCCCGCCCCCGCA TCAGTTTCACGCTCACCCCGTCCGCTGTCGGTTTCCCTGCGAGAGCGTTGAGGAG GTATGTTCATGGTCAAGAGAACTGGTCCGACCGATATCAACCTGAGGAGGCTAATCCGGTACCTCAGAAAGAAGTCGAAT GAAGAGGGAGTTAGGATATGGAAGGACATCGCCTGGCGCCTTGAAAGGCCGAGGAGGCAGAGGGCTGAAGTGAACGTTAG CAAGATAAACCGCTATACCAAAGAGGGCGACGTGGTCATCGTTCCGGGAAGCGTCCTCGGTGCAGGAAAGCTTGAGCACA GGGTCACCGTTGCCGCTTGGAAGTTCAGCGAGACCGCTAAGAGGAAAATCCTCGAGGCCGGTGGCGAGGCCATCACCATT GAGGAGCTTATGGAGAGAAATCCGAAGGGTAGTGGAGTAATCATAATGGAGTGATGGGCCATGAGGATTATTAACGCTGA AGGACTCATACTCGGAAGGCTCGCCTCGAAGGTTGCCAAGATGCTC