tg_tRNA-Pro3

Coordinates:1882707-1882784

>tg_tRNA-Pro3 tRNA-Pro (GGG)
GGGGCCGTGGGGTAGCTTGGTCTATCCTCCCGGCTTGGGGTGCCGGAGACCCGGGTTCAA
ATCCCGGCGGCCCCACCA
>tg_tRNA-Pro3 tRNA-Pro (GGG)
GGGGCCGTGGGGTAGCTTGGTCTATCCTCCCGGCTTGGGGTGCCGGAGACCCGGGTTCAA
ATCCCGGCGGCCCCACCA


Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1882207 - 1883284 (Additional range around tg_tRNA-Pro3 is :500nt.)

>Thermococcus gammatolerans EJ3 GAGAGGAGATAGTCAGCAAGGTTGACATCGACGTCAAGGTCGAGGGCGGAGGCTTCATGGGTCAGGCCGAGGCCGCGCGC GTTGCCATCGCCAGGGCTCTCGTTGAGTGGACCAACGACATGAACCTGAAGGAAAAGTTTATGAAGTACGACAGGACTAT GCTCGTTGGCGACAGCAGGAGGACCGAGCCCCACAAGCCCAACCGCTCGACCAAGGGTCCGAGGGCTAAGAGGCAGAAGT CCTACCGCTGATGGCTTTCCTTTAACAATTTGAGGTGTGAGAAAATGATAGTCCCCGTCAGGTGCTTCACCTGCGGAAAA GTGCTGGCGGACAAGTACTACGAGTTCAGGAAGAGAGTTGAGGCCGGGGAAGACCCTGGCAAGGTCCTCGATGACCTCGG CGTTGAGAGGTACTGCTGCAGGAGAACTCTCCTCAGCCACGTGGAGCTCATCGACCAGGTAATGGTTTATAAAGTCTACT AAAAACCGCAATTCTTGG GGGGCCGTGGGGTAGCTTGGTCTATCCTCCCGGCTTGGGGTGCCGGAGACCCGGGTTCAAA TCCCGGCGGCCCCACCA AAATTTGCAGAGGATGCTTGGAGGGAGGGCAATGTTTAGGTACACCCGCTTTGAAAAGGCCC GTATCATCGGGGCGAGAGCTCTCCAGATTGCGCTCGGTGCTCCGGTCCTAGTGGACGTGCCGGAAGGCTCAACTCCACTT CAGGCCGCGATAATCGAGTTCGAGAAAGGAATAATCCCGATCACAGTAATCAGGCCGAGCTGATGAAAAATGACCATCAT AGAGAACGTTATCGGCAGGGTGGCCGTACTCAGGGGCGGCAAGTATTCGGTTGAGGTGGACGTCATAACCAGTTCGGGCT TTGGTCGATTCGCCGCCCCCATCGATGAGGATCCCCACCTTTACATAGCCGAAGCACATAGAGCCGTGAGTGAAGTCGAC GAGATAATAGGGCCCGAGCTTATAGGCTTCGATGCCAGTGAGCAGGAGCTCATAGACAGTTACCTGTGGGAAATTGACGG GACTGATGATTTCAGTCACATCGGGGCCAACACTGCCCT